Home Food & Medicine Homology Article
PDF (2.4 MB)
Cite
EndNote(RIS) BibTeX
Collect
Submit Manuscript
Show Outline
Figures (3)

Tables (5)
Table 1
Table 2
Table 3
Table 4
Table 5
Research Article | Open Access | Online First

Casein or soy protein supplementation protects against hepatotoxicity in hypercholesterolemic rats treated with rosuvastatin

Mosaad A. Abdel-Wahhab1(), Aziza A. El-Nekeety1, Mona A. Hassan2, Sekena H. Abdel-Aziem3, Nabila S. Hassan4
Food Toxicology and Contaminants Department, National Research Centre, Cairo 12622, Egypt
Food Evaluation and Food Science Department, National Organization for Drug Control and Research, Giza 12553, Egypt
Cell Biology Department, National Research Centre, Cairo 12622, Egypt
Pathology Department, National Research Centre, Cairo 12622, Egypt
Show Author Information

Highlights

(1) Rosuvastatin (Rsv) improves lipid profile in hypercholesterolemic rats (HCD).

(2) Rsv induces hepatic and renal oxidative stress and disturbs gene expression in HCD.

(3) Dietary soy protein and casein improved all the tested parameters in HCD.

(4) Soy protein was more effective than casein.

Graphical Abstract

View original image Download original image
Rosuvastatin (Rvs) is used for hypercholesterolemia therapeutic but it induces adverse effects including hepatotoxicity. We evaluated the hepatoprotective role of casein and soy protein in hypercholesterolemic rats received Rvs. Rvs improved lipid profile in hypercholesterolemic rats, but it disturbed the liver and kidney indices, oxidative stress markers, the hepatic mRNA expression of SREBP-1c, SREBP-2, FAS, and ACC-1 and the histopathological picture in hypercholesterolemic rats. Casein and soy protein improved the all the tested parameters, the histological picture, and modified the related gene expressions. Soy protein was more effective than casein and both of them can protect against Rvs-induced hepatotoxicity under hypercholesterolemic conditions.

Abstract

Rosuvastatin (Rvs) is used for hypercholesterolemia therapeutic but it induces adverse effects including hepatotoxicity. This study aimed to evaluate the hepatoprotective role of casein and soy protein in hypercholesterolemic rats received Rvs. Seven groups of male Wistar rats were treated for 8 weeks including; control group, high-cholesterol diet (HCD) group, the groups treated orally with casein or soy protein (300 mg/kg bw) suspended in distilled water, the group received HCD for 4 weeks and treated orally with Rvs (20 mg/kg bw) for another 4 weeks, and the groups received HCD for 4 weeks and treated orally with casein or soy protein for another 4 weeks. Blood and tissue samples were collected for different assays. The results indicated that Rvs improved lipid profile in hypercholesterolemic rats, but it disturbed the liver and kidney indices, oxidative stress markers, the hepatic mRNA expression of SREBP-1c, SREBP-2, FAS, and ACC-1 and the histopathological picture in hypercholesterolemic rats. Casein and soy protein improved the all the tested parameters, the histological picture, and mRNA expression of the tested genes, and soy protein was more effective than casein. Casein and soy protein supplementation can protect against Rvs-induced hepatotoxicity under hypercholesterolemic conditions.

Keywords

rosuvastatinhypercholesterolemiacaseinsoy proteinhepatoprotective

References

[1]

Fontana, R. J., Seeff, L. B., Andrade, R. J., et al. Standardization of nomenclature and causality assessment in drug-induced liver injury: summary of a clinical research workshop. Hepatology, 2010, 52: 730–742. https://doi.org/10.1002/hep.23696

Crossref Google Scholar
[2]

Garcia-Cortes, M., Robles-Diaz, M., Stephens, C., et al. Drug induced liver injury: an update. Archives of Toxicology, 2020, 94: 3381–3407. https://doi.org/10.1007/s00204-020-02885-1

Crossref Google Scholar
[3]

Hassan A., Fontana R. J. The diagnosis and management of idiosyncratic drug-induced liver injury. Liver International, 2019, 39: 31–41. https://doi.org/10.1111/liv.13931

Crossref Google Scholar
[4]

Andrade, R. J., Chalasani, N., Björnsson, E. S., et al. Drug-induced liver injury. Nature Review Disease Primers, 2019, 5: 58. https://doi.org/10.1038/s41572-019-0105-0

Crossref Google Scholar
[5]

Hussaini, S. H., O'Brien, C. S., Despott, E. J., et al. Antibiotic therapy: a major cause of drug-induced jaundice in southwest. European Journal of Gastroenterology & Hepatology, 2007, 19: 15–20. https://doi.org/10.1097/01.meg.0000250581.77865.68

Crossref Google Scholar
[6]

Pedraza, L., Laosa, O., Rodríguez-Mañas, L., et al. Drug induced liver injury in geriatric patients detected by a two-hospital prospective pharmacovigilance program: a comprehensive analysis using the Roussel Uclaf causality assessment method. Frontiers in Pharmacology, 2021, 11: 600255. https://doi.org/10.3389/fphar.2020.600255

Crossref Google Scholar
[7]

Baekdal, M., Ytting, H., Kjær, M. S. Drug-induced liver injury: a cohort study on patients referred to the Danish transplant center over a five years period. Scandinavian Journal of Gastroenterology, 2017, 52: 450–454. https://doi.org/10.1080/00365521.2016.1267790

Crossref Google Scholar
[8]

Pillans, P. I. Drug associated hepatic reactions in New Zealand: 21-years’ experience. New Zaland Medical Journal, 1996, 109: 315–319.

Google Scholar
[9]
Sunil Kumar, N., Remalayam, B., Thomas, V., Outcomes and predictors of mortality in patients with drug-induced liver injury at a tertiary hospital in South India: a single-centre experience. Journal of Clinical Experimental Hepatology, 2021 , 11: 163-170. https://doi.org/10.1016/j.jceh.2020.08.008
Crossref
[10]

Larrey, D., Meunier, L., Valla, D., et al. Drug induced liver injury and vascular liver disease. Clinics & Research in Hepatology& Gastroenterology, 2020, 44: 471–479. https://doi.org/10.1016/j.clinre.2020.03.020

Crossref Google Scholar
[11]

Chalasani, N., Bonkovsky, H. L., Fontana, R., et al. Features and outcomes of 899 patients with drug-induced liver injury: the DILIN prospective study. Gastroenterology, 2015, 148: 1340–1352. https://doi.org/10.1053/j.gastro.2015.03.006

Crossref Google Scholar
[12]
F.D.A. Drug-Induced Liver Injury: Premarketing Clinical Evaluation. http://www.fda.gov/downloads/Drugs/GuidanceComplianceRegulatoryInformation/Guidances/UCM174090.pdf (Accessed 18 April 2013).
[13]

Lee, M. M. Y., Sattar, N., McMurray, J. J. V., et al. Statins in the prevention and treatment of heart failure: a review of the evidence. Current Atherosclerosis Reports, 2019, 21: 41 https://doi.org/10.1007/s11883-019-0800-z

Crossref Google Scholar
[14]

Zhong, P., Wu, D., Ye, X., et al. Secondary prevention of major cerebrovascular events with seven different statins: a multi-treatment meta-analysis. Drug Desigen Development & Therapy, 2017, 1: 2517–2526. https://doi.org/10.2147/DDDT.S135785

Crossref Google Scholar
[15]

Salagre, E., Fernandes, B. S., Dodd, S., et al. Statins for the treatment of depression: a meta-analysis of randomized, double-blind, placebo-controlled trials. Journal of Affective Disords, 2016, 200: 235–242. https://doi.org/10.1016/j.jad.2016.04.047

Crossref Google Scholar
[16]

Qiu, S., Zhuo, W., Sun, C., et al. Effects of atorvastatin on chronic subdural hematoma: a systematic review. Medicine, 2017, 96: e7290. https://doi.org/10.1097/MD.0000000000007290

Crossref Google Scholar
[17]
Archibugi, L., Arcidiacono, P. G., Capurso, G., Statin use is associated to a reduced risk of pancreatic cancer: a meta-analysis. Digestive & Liver Disease, 2019 , 51: 28–37. https://doi.org/10.1016/j.dld.2018.09.007
Crossref
[18]

Li, G. M., Zhao, J., Li, B., et al. The anti-inflammatory effects of statins on patients with rheumatoid arthritis: a systemic review and meta-analysis of 15 randomized controlled trials. Autoimmunity Reviews, 2018, 17: 215–225. https://doi.org/10.1016/j.autrev.2017.10.013

Crossref Google Scholar
[19]

Liu, L. Y., Liu, Y., Wu, M. Y., et al. Efficacy of atorvastatin on the prevention of contrast-induced acute kidney injury: meta-analysis. Drug Desigen Development & Therapy, 2018, 12: 437–444. https://doi.org/10.2147/DDDT.S149106

Crossref Google Scholar
[20]

Athyros, V. G., Tziomalos, K., Karagiannis, A., et al. Atorvastatin: safety and tolerability. Expert Opinion in Drug Safety, 2010, 9: 667–674. https://doi.org/10.1517/14740338.2010.495385

Crossref Google Scholar
[21]

Indumathi, C., Anusha, N., Vinod, K. V., et al. Atorvastatin induced adverse drug reactions among South Indian Tamils. Journal of Clinical & Diagnosis Research, 2017, 11: Fc01–fc05. https://doi.org/10.7860/JCDR/2017/27223.10175

Crossref Google Scholar
[22]
McIver, L. A., Siddique, M. S., Atorvastatin. In: Stat Pearls. Stat Pearls Publishing, 2019 .
[23]
LiverTox, Clinical and research information on drug-induced liver injury. National Institute of Diabetes and Digestive and Kidney Diseases. Rosuvastatin, 2012.
[24]

Liu, M., Alafris, A., Longo, A. J., et al. Irreversible atorvastatin-associated hearing loss. Pharmacotherapy, 2012, 32: e27–e34. https://doi.org/10.1002/PHAR.104

Crossref Google Scholar
[25]

Björnsson, E. S. Hepatotoxicity of statins and other lipid-lowering agents. Liver International, 2017, 37: 173–178. https://doi.org/10.1111/liv.13308

Crossref Google Scholar
[26]

Cohen, D. E., Anania, F. A., Chalasani, N. An assessment of statin safety by hepatologists. American Journal of Cardiology, 2006, 97: S77–S81. https://doi.org/10.1016/j.amjcard.2005.12.014

Crossref Google Scholar
[27]
Björnsson, E., Jacobsen, E. I., Kalaitzakis, E., Hepatotoxicity associated with statins: reports of idiosyncratic liver injury post-marketing. Journal of Hepatology, 2012 , 56: 374-380H.
Crossref
[28]

Bays, H., Cohen, D. E., Chalasani, N., et al. The national lipid association’s statin safety task force. an assessment by the statin liver safety task force: 2014 update. Journal of Clinical Lipidology, 2014, 8: S47–S57. https://doi.org/10.1016/j.jhep.2011.07.023

Crossref Google Scholar
[29]
Stagnitti, Trends in utilization and expenditures for the US civilian noninstitutionalized population, 2000-2005. Agency for Healthcare Research and Quality Statistical Brief, 2008 .
[30]
FCHP. Fallon Community Health Plan, Making more cost-effective health care choices start here. 2009 . https://fallonhealth.org/en/About/newsroom/2024/Community-Care-service-area-expansion
[31]

Ramdath, D. D., Padhi, E. M., Sarfaraz, S., et al. Beyond the cholesterol-lowering effect of soy protein: a review of the effects of dietary soy and its constituents on risk factors for cardiovascular disease. Nutrients, 2017, 9: 324. https://doi.org/10.3390/nu9040324

Crossref Google Scholar
[32]

Torres, N., Torre-Villalvazo, I., Tovar, A. R. Regulation of lipid metabolism by soy protein and its implication in diseases mediated by lipid disorders. Journal of Nutritional Biochemistry, 2006, 17: 365–373. https://doi.org/10.1016/j.jnutbio.2005.11.005

Crossref Google Scholar
[33]

Maki, K. C., Butteiger, D. N., Rains, T. M., et al. Effects of soy protein on lipoprotein lipids and fecal bile acid excretion in men and women with moderate hypercholesterolemia. Journal of Clinical Lipidology, 2010, 4: 531–542. https://doi.org/10.1016/j.jacl.2010.09.001

Crossref Google Scholar
[34]
Health Canada, Summary of health Canada's assessment of a health claim about soy protein and cholesterol Lowering. http://www.hc-sc.gc.ca/fn-an/label-etiquet/claims-reclam/assess-evalu/soy-protein-cholesterol-eng.php (accessed on 28 September 2016
[35]
Dixit, A. K., Antony, J. I. X., Sharma, N. K., et al. http://www.trnres.com/ebook/uploads/tiwari/T_1302158885Tiwari-12.pdf (accessed on 10 January 2017
[36]

Hu, J., Gao, Q., Zhang, Y., et al. Soy fiber improves weight loss and lipid profile in overweight and obese adults: a randomized controlled trial. Molecular Nutrition & Food Research, 2013, 57: 2147–2154. https://doi.org/10.1002/mnfr.201300159

Crossref Google Scholar
[37]

McCue, P., Kalidas, S. Health benefits of soy iso-flavonoids and strategies for enhancements: a review. Critical Review in Food Science Nutrition, 2004, 44: 361–367. https://doi.org/10.1080/10408690490509591

Crossref Google Scholar
[38]

McGraw, N. J., Krul, E. S., Grunz-Borgmann, E., et al. Soy-based renoprotection. World Journal of Nephrology, 2016, 5: 233–257. https://doi.org/10.5527/wjn.v5.i3.233

Crossref Google Scholar
[39]
Omoni, A. O., Aluko, R. E., Soybean foods and their benefits: potential mechanisms of action. Nutrition Reviews, 2005 , 63: 272–283. https://doi.org/10.1111/j.1753-4887.2005.tb00141.x
Crossref
[40]

Rebholz, C. M., Friedman, E. E., Powers, L. J., et al. Dietary protein intake and blood pressure: a meta-analysis of randomized controlled trials. American Journal of Epidemiology, 2012, 176: S27–S43. https://doi.org/10.1093/aje/kws245

Crossref Google Scholar
[41]

Martínez-Augustin, O., Rivero-Gutiérrez, B., Mascaraque, C., et al. Food derived bioactive peptides and intestinal barrier function. International Journal of Molecular Sciences, 2014, 15: 22857–22873. https://doi.org/10.3390/ijms151222857

Crossref Google Scholar
[42]

Suwal, S., Silveira Porto Oliveira, R., Pimont-Farge, M., et al. Formation of stable supramolecular structure with β-lactoglobulin-derived self-assembling peptide F1-8 and bovine micellar caseins. Journal of Agricultural & Food Chemistry, 2019, 67: 1269–1276. https://doi.org/10.1021/acs.jafc.8b05584

Crossref Google Scholar
[43]
Sadiq, U., Gill, H., Chandrapala, J., Casein micelles as an emerging delivery system for bioactive food components. Foods, 2021 , 10: 1965. https://doi.org/10.3390/foods10081965
Crossref
[44]

Carter, B. G., Cheng, N., Kapoor, R., et al. Invited review: microfiltration-derived casein and whey proteins from milk. Journal of Dairy Science, 2021, 104: 2465–2479. https://doi.org/10.3168/jds.2020-18811

Crossref Google Scholar
[45]

Nagaoka, S., Futamura, Y., Miwa, K., et al. Identification of novel hypo-cholesterolemic peptides derived from bovine milk beta-lactoglobulin. Biochemical Biophysical Research Communication, 2001, 281: 11–17. https://doi.org/10.1006/bbrc.2001.4298

Crossref Google Scholar
[46]
Yamauchi, R., Ohinata, K., Yoshikawa, M. β-Lactotensin and neurotensin rapidly reduce serum cholesterol via NT2 receptor. Peptides, 2003 , 24: 1955–1961. https://doi.org/10.1016/j.peptides.2003.10.003
Crossref
[47]

El-Tantawy, W. H., Temraz, A. Natural products for controlling hyperlipidemia: review. Archives of Physiology Biochemistry, 2019, 125: 128–135. https://doi.org/10.1080/13813455.2018.1441315

Crossref Google Scholar
[48]

Nagaoka, S. Structure-function properties of hypolipidemic peptides. Journal Food Biochemistry, 2019, 43: e12539. https://doi.org/10.1111/jfbc.12539

Crossref Google Scholar
[49]

Boachie, R., Yao, S., Udenigwe, C. C. Molecular mechanisms of cholesterol-lowering peptides derived from food proteins. Opinion in Food Science, 2018, 20: 58–63. https://doi.org/10.1016/j.cofs.2018.03.006

Crossref Google Scholar
[50]

Duranti, M, Lovati, M. R., Dani, V., et al. The alpha' subunit from soybean 7S globulin lowers plasma lipids and upregulates liver beta-VLDL receptors in rats fed a hypercholesterolemic diet. Journal of Nutrition, 2004, 134: 1334–1339. https://doi.org/10.1093/jn/134.6.1334

Crossref Google Scholar
[51]

Jiang, X., Pan, D., Zhang, T., et al. Novel milk casein-derived peptides decrease cholesterol micellar solubility and cholesterol intestinal absorption in Caco-2 cells. Journal of Dairy Science, 2020, 103: 3924–3936. https://doi.org/10.3168/jds.2019-17586

Crossref Google Scholar
[52]

Lin, C. C., Hsu, Y. F., Lin, T. C., et al. Antioxidant and hepatoprotective activity of punicalagin and punicalin on carbon tetrachloride induced liver damage in rats. Journal of Pharmacy & Pharmacology, 1998, 50: 789. https://doi.org/10.1111/j.2042-7158.1998

Crossref Google Scholar
[53]
Bancroft, D., Stevens, A., Turmer, R. Theory and practice of histological technique, fourth ed., Churchill Living Stone, Edinburgh, 1996 , pp. 36–42.
[54]

Kim, H. D., Shay, T., O'Shea, E. K., et al. Transcriptional regulatory circuits: predicting numbers from alphabets. Science, 2009, 325: 429–432. https://doi.org/10.1126/science.1171347

Crossref Google Scholar
[55]
Livak, K. J. ABI Prism 7700 Sequence Detection System, User Bulletin 2. PE Applied Biosystems. 1997 .
[56]

Schierwagen, R., Uschner, F. E., Magdaleno, F., et al. Rationale for the use of statins in liver disease. American Journal of Physiology-Gastrointestinal Liver Physiology, 2017, 312: G407–G412. https://doi.org/10.1152/ajpgi.00441.2016

Crossref Google Scholar
[57]

Yang, Y. H., Yang, J., Jiang, Q. H. Hypolipidemic effect of gypenosides in experimentally induced hypercholesterolemic rats. Lipids Health Disease, 2013, 12: 154. https://doi.org/10.1186/1476-511X-12-154

Crossref Google Scholar
[58]
E. R. F. Ezetimibe and Rosuvastatin Formulation HH CA EN.pdf (organon.com), 2021 .
[59]

Cohn, J. S., Kimpton, W. G., Nestel, P. J. The effect of dietary casein and soy protein on cholesterol and very low-density lipoprotein metabolism in the rat. Atherosclerosis, 1984, 52: 219–231. https://doi.org/10.1016/0021-9150(84)90120-5

Crossref Google Scholar
[60]

Aly-Aldin, M. M., Mansour, E. H., Rahma, A. H., et al. Protective role of flaxseed oil on hypercholesterolemic rats. Biolife, 2015, 3: 794–801. https://doi.org/10.5281/zenodo.7302710

Crossref Google Scholar
[61]

Jones, P. Regulation of cholesterol biosynthesis by diet in humans. American Journal of Clinical Nutrition, 1997, 66: 438–446. https://doi.org/10.1093/ajcn/66.2.438

Crossref Google Scholar
[62]

Swelim, R., Farid, A. S., Fararh, K. M. Hypolipidemic effects of barley- β-glucan in experimentally induced hyperlipidemic rats. Benha Veterinary Medical Journal, 2019, 36: 13–23. https://doi.org/10.21608/BVMJ.2019.11832.1000

Crossref Google Scholar
[63]

Chen, Y., Yin, M., Cao, X., et al. Pro- and anti-inflammatory effects of high cholesterol diet on aged brain. Aging Disease, 2018, 9: 374–390. https://doi.org/10.14336/AD.2017.0706

Crossref Google Scholar
[64]

El-Nekeety, A. A., Hassan, M. E., Hassan, R. R., et al. Nanoencapsulation of basil essential oil alleviates the oxidative stress, genotoxicity and DNA damage in rats exposed to biosynthesized iron nanoparticles. Heliyon, 2021, 7: e07537. https://doi.org/10.1016/j.heliyon.2021e07537

Crossref Google Scholar
[65]

Zhang, F. L., Xing, Y. Q., Wu, Y. H., et al. The prevalence, awareness, treatment, and control of dyslipidemia in northeast China: a population-based cross-sectional survey. Lipids Health Disease, 2017, 16: 1–13. https://doi.org/10.1186/s12944-017-0453-2

Crossref Google Scholar
[66]

Giannini, E. G., Testa, R., Savarino, V. Liver enzyme alteration: a guide for clinicians. Candain Medical Association Journal, 2005, 72: 367–379. https://doi.org/10.1503/cmaj.1040752

Crossref Google Scholar
[67]

Islam, S., Rahman, S., Haque, T., et al. Prevalence of elevated liver enzymes and its association with type 2 diabetes: a cross-sectional study in Bangladeshi adults. Endocrinology, Diabetes & Metabolism Journal, 2020, 3: e00116. https://doi.org/10.1002/edm2.116

Crossref Google Scholar
[68]

Sanyal, D., Mukherjee, P., Raychaudhuri, M., et al. Profile of liver enzymes in non-alcoholic fatty liver disease in patients with impaired glucose tolerance and newly detected untreated type 2 diabetes. Indian Journal of Endocrinology & Metabolism, 2015, 19: 597–601. https://doi.org/10.4103/2230-8210.163172

Crossref Google Scholar
[69]

de Miranda, A. M., Ribeiro, G. M., Cunha, A. C., et al. Hypolipidemic effect of the edible mushroom Agaricus blazei in rats subjected to a hypercholesterolemic diet. Journal of Physiology & Biochemistry, 2014, 70: 215–224. https://doi.org/10.1007/s13105-013-0295-y

Crossref Google Scholar
[70]

Arauz, J., Ramos-Tovar, E., Muriel, P. Redox state and methods to evaluate oxidative stress in liver damage: from bench to bedside. Annals of Hepatology, 2016, 15: 160–173. https://doi.org/10.5604/16652681.1193701

Crossref Google Scholar
[71]

Kathak, R. R., Sumon, A. H., Molla, N. H., et al. The association between elevated lipid profile and liver enzymes: a study on Bangladeshi adults. Science Reports, 2022, 12: 1711. https://doi.org/10.1038/s41598-022-05766-y

Crossref Google Scholar
[72]

Arisha, S. M., Saif, M. E., Kandil, E. H. Histological, ultrastructural and immune-histochemical studies on the ameliorative role of Cinnamon zeylanicum against high cholesterol diet-induced hypercholesterolemia in the kidney of adult male albino rats. Heliyon, 2022, 8: e10401. https://doi.org/10.1016/j.heliyon.2022.e10401

Crossref Google Scholar
[73]

Al Saad, A. M., Mohany, M., Almalki, M. S., et al. Baicalein neutralizes hypercholesterolemia induced aggravation of oxidative injury in rats. International Journal of Medical Sciences, 2020, 17: 1156–1166. https://doi.org/10.7150/ijms.46108

Crossref Google Scholar
[74]
Bin-Jumah, M. N. Monolluma quadrangular protects against oxidative stress and modulates LDL receptor and fatty acid synthase gene expression in hypercholesterolemic rats. Oxidative Medicine & Cellular Longevity, 2018 : 3914384. https://doi.org/10.1155/2018/3914384
Crossref
[75]

Lee, K. S., Chun, S. Y., Kwon, Y. S., et al. Deep-Sea water improves hypercholesterolemia and hepatic lipid accumulation through the regulation of hepatic lipid metabolic gene expression. Molecular Medicine Reports, 2017, 15: 2814–2822. https://doi.org/10.3892/mmr.2017.6317

Crossref Google Scholar
[76]

Ma, Y., Wang, W., Zhang, J., et al. Hyperlipidemia and atherosclerotic lesion development in LDLR-deficient mice on a long-term high-fat diet. PLoS One, 2012, 7: e35835. https://doi.org/10.1371/journal.pone.0035835

Crossref Google Scholar
[77]

Günther, J., Schneider, I., Krämer, A. Carvone prevents and alleviates hepatic steatosis in rat model with nonalcoholic fatty liver disease. GMJ Medicine, 2019, 3: 118–124. https://doi.org/10.29088/GMJM.2019.118

Crossref Google Scholar
[78]

Horton, J. D., Shah, N. A., Warrington, J. A., et al. Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proceeding of the National Academy of Sciences USA, 2003, 100: 12027–12032. https://doi.org/10.1073/pnas.1534923100

Crossref Google Scholar
[79]

Xu, X., So, J. S., Park, J. G., et al. Transcriptional control of hepatic lipid metabolism by SREBP and ChREBP. Semin. Liver Disease, 2013, 33: 301–311. https://doi.org/10.1055/s-0033-1358523

Crossref Google Scholar
[80]
Kobayashi, M., Fujii, N., Narita, T., et al. SREBP-1c-dependent metabolic remodeling of white adipose tissue by caloric restriction International Journal of Molecular Sciences, 2018 , 19: 3335. https://doi.org/10.3390/ijms19113335
Crossref
[81]

Moslehi, A., Hamidi-zad, Z. Role of SREBPs in liver diseases: a mini-review. Journal of Clinical & Translational Hepatology, 2018, 6: 332–338. https://doi.org/10.14218/JCTH.2017.00061

Crossref Google Scholar
[82]

Feng, D., Zou, J., Su, D., et al. Curcumin prevents high-fat diet-induced hepatic steatosis in ApoE−/− mice by improving intestinal barrier function and reducing endotoxin and liver TLR4/NF-κB inflammation. Nutrition & Metabolism, 2019, 16: 79. https://doi.org/10.1186/s12986-019-0410-3

Crossref Google Scholar
[83]

Kostogrys, R. B., Franczyk-Żarów, M., Kus, E., et al. LCHP diet enriched with cholesterol promotes non-alcoholic fatty liver disease in Wistar rats. Applied Science, 2022, 12: 8266. https://doi.org/10.3390/app12168266

Crossref Google Scholar
[84]

Koubaa-Ghorbel, F., Chaabane, M., Turki, M., et al. The protective effects of Salvia officinalis essential oil compared to simvastatin against hyperlipidemia, liver, and kidney injuries in mice submitted to a high-fat diet. Journal of Food Biochemistry, 2020, 44: e13160. https://doi.org/10.1111/jfbc.13160

Crossref Google Scholar
[85]

Tornio, A., Pasanen, M. K., Laitila, J., et al. Comparison of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins) as inhibitors of cytochrome P450 2C8. Basic & Clinical Pharmacology Toxicology, 2005, 97: 104–108. https://doi.org/10.1111/j.1742-7843.2005.pto_134.x

Crossref Google Scholar
[86]

Famularo, G., Miele, L., Minisola, G., et al. Liver toxicity of rosuvastatin therapy. World Journal Gastroenterology, 2007, 138: 1286–1288. https://doi.org/10.3748/wjg.v13.i8.1286

Crossref Google Scholar
[87]

Korhonen, H. Milk-derived bioactive peptides: from science to applications. Journal of Functional Foods, 2009, 1: 177–187. https://doi.org/10.1111/bcp.13002

Crossref Google Scholar
[88]

Castellano, P., Mora, L., Escudero, E., et al. Antilisterial peptides from Spanish dry-cured hams: purification and identification. Food Microbiology, 2016, 59: 133–141. https://doi.org/10.1016/j.fm.2016.05.018

Crossref Google Scholar
[89]

Vitale, K., Getzin, A. Nutrition and supplement update for the endurance athlete: review and recommendations. Nutrients, 2019, 11: 1289. https://doi.org/10.3390/nu11061289

Crossref Google Scholar
[90]

Baker, B. E., Lauer, B. H., Casein, X. The carbohydrate content of casein prepared from the milks of different species. Canadian Journal of Zoology, 1971, 49: 551–554. https://doi.org/10.1139/z71-083

Crossref Google Scholar
[91]

Dunshea, F. R., Walker, G. P., Williams, R., et al. Mineral and citrate concentrations in milk are affected by seasons, stage of lactation and management practices. Agriculture, 2019, 9: 25. https://doi.org/10.3390/agriculture9020025

Crossref Google Scholar
[92]

Wang, C., Zheng, L., Su, G., et al. Evaluation and exploration of potentially bioactive peptides in casein hydrolysates against liver oxidative damage in STZ/HFD-induced diabetic rats. Journal of Agricultural & Food Chemistry, 2020, 68: 2393–2405. https://doi.org/10.1021/acs.jafc.9b07687

Crossref Google Scholar
[93]

Shazly, A. B., Mu, H., Liu, Z., et al. Release of antioxidant peptides from Buffalo and Bovine caseins: influence of proteases on antioxidant capacities. Food Chemistry, 2019, 274: 261–267. https://doi.org/10.1016/j.foodchem.2018.08.137

Crossref Google Scholar
[94]

Xu, S., Mao, X., Cheng, X., et al. Ameliorating effects of casein glycomacropeptide on obesity induced by high-fat diet in male Sprague-Dawley rats. Food & Chemical Toxicology, 2013, 56: 1–7. https://doi.org/10.1016/j.fct.2013.01.027

Crossref Google Scholar
[95]

Nielsen, S. D., Beverly, R. L., Qu, Y., et al. Milk bioactive peptide database: a comprehensive database of milk protein-derived bioactive peptides and novel visualization. Food Chemistry, 2017, 232: 673–682. https://doi.org/10.1016/j.foodchem.2017.04.056

Crossref Google Scholar
[96]

Medjakovic, S., Jungbauer, A. Red clover isoflavones biochanin A and formononetin are potent ligands of the human aryl hydrocarbon receptor. Journal of Steroid Biochemistry & Molecular Biology, 2008, 108: 171–177. https://doi.org/10.1016/j.jsbmb.2007.10.001

Crossref Google Scholar
[97]

Lavigne, C., Marette, A., Jacques, H. Cod and soy proteins compared with casein improve glucose tolerance and insulin sensitivity in rats. American Journal Physiology Endocrinology Metabolism, 2000, 278: E491–E500. https://doi.org/10.1152/ajpendo.2000.278.3.E491

Crossref Google Scholar
[98]

Mauriz, J. L., Matilla, B., Culebras, J. M., et al. Dietary glycine inhibits activation of nuclear factor kappa B and prevents liver injury in hemorrhagic shock in the rat. Free Radical Biology & Medicine, 2001, 31: 1236–1244. https://doi.org/10.1016/s0891-5849(01)00716-x

Crossref Google Scholar
[99]

Mariotti, F., Simbelie, K. L., Makarios-Lahham, L., et al. Acute ingestion of dietary proteins improves post-exercise liver glutathione in rats in a dose-dependent relationship with their cysteine content. Journal of Nutrition, 2004, 134: 128–131. https://doi.org/10.1093/jn/134.1.128

Crossref Google Scholar
[100]

Anderson, J. W., Blake, J. E., Smith, B. M. Effects of soy protein on renal function and proteinuria in patients with type 2 diabetes. American Journal of Clinical Nutrition, 1998, 68: 1347S–53S. https://doi.org/10.1093/ajcn/68.6.1347S

Crossref Google Scholar
[101]

Anderson, J. W., Johnstone, B. M., Cook-Newell, M. E. Meta-analysis of the effects of soy protein intake on serum lipids. New England Journal of Medicine, 1995, 333: 276–282. https://doi.org/10.1056/NEJM199508033330502

Crossref Google Scholar
[102]

Ascencio, C., Torres, N., Isoard-Acosta, F., et al. Soy protein affects serum insulin and hepatic SREBP-1 mRNA and reduces fatty liver in rats. Journal of Nutrition, 2004, 134: 522–529. https://doi.org/10.1093/jn/134.3.522

Crossref Google Scholar
[103]

Hernandez-Montes, E., Pollard, S. E., Vauzour, D., et al. Activation of glutathione peroxidase via Nrf1 mediates genistein’s protection against oxidative endothelial cell injury. Biochemical & Biophysical Research Communication, 2006, 346: 851–859. https://doi.org/10.1016/j.bbrc.2006.05.197

Crossref Google Scholar
[104]

Cheng-Lai, A. Rosuvastatin: a new HMG-CoA reductase inhibitor for the treatment of hypercholesterolemia. Heart Disease, 2003, 5: 72–78. https://doi.org/10.1586/14779072.1.4.495

Crossref Google Scholar
[105]

Banno, A., Wang, J., Okada, K., et al. Identification of a novel cholesterol-lowering dipeptide, phenylalanine-proline (FP), and its down-regulation of intestinal ABCA1 in hypercholesterolemic rats and Caco-2 cells. Scientific Reports, 2019, 9: 19416. https://doi.org/10.1038/s41598-019-56031-8

Crossref Google Scholar
[106]

Guermani-Nicolle, L., Villaume, C., Bau, H. M., et al. The cholesterol-lowering property of soybeans fed to rats is related to the fasting duration. Plant Foods for Human Nutrition, 2001, 56: 239–249. https://doi.org/10.1023/a:1011144031646

Crossref Google Scholar
[107]

Jayawardana, K. S., Mundra, P. A., Giles, C., et al. Changes in plasma lipids predict pravastatin efficacy in secondary prevention. JCI Insight, 2019, 4: e128438. https://doi.org/10.1172/jci.insight.128438

Crossref Google Scholar
[108]

Sugiyama, K., Shimada, Y., Iwai, K., et al. Differential effects of dietary casein and soybean protein isolate on lipopolysaccharide-induced hepatitis in D-galactosamine-sensitized rats. Bioscience, Biotechnology, and Biochemistry, 2002, 66: 2232–2235. https://doi.org/10.1271/bbb.66.2232

Crossref Google Scholar
[109]

Hamad, E. M., Taha, S. H., Abou Dawood, A. I., et al. Protective effect of whey proteins against nonalcoholic fatty liver in rats. Lipids Health Disease, 2011, 10: 57. https://doi.org/10.1186/1476-511X-10-57

Crossref Google Scholar
[110]

Sreeja, S., Geetha, R., Priyadarshini, E., et al. Substitution of soy protein for casein prevents oxidative modification and inflammatory response induced in rats fed high fructose diet. ISRN Inflammation, 2014, 2014: 641096. https://doi.org/10.1155/2014/641096

Crossref Google Scholar
Food & Medicine Homology
DOI: 10.26599/FMH.2026.9420088
Cite this article:
Abdel-Wahhab MA, El-Nekeety AA, Hassan MA, et al. Casein or soy protein supplementation protects against hepatotoxicity in hypercholesterolemic rats treated with rosuvastatin. Food & Medicine Homology, 2025, https://doi.org/10.26599/FMH.2026.9420088
Metrics & Citations  
Article History
Copyright
Rights and Permissions
Return

Details giving primer sequences for the genes amplified

cDNASequence from (5’ to 3’)Accession numberRT-PCR product size (bp)
SREBP-1cF: GGAGCCATGGATTGCACATTR: AGGAAGGCTTCCAGAGAGGANM_001276708.1191
SREBP 2F: GTGCAGACAGTCGCTACACCR: AATCTGAGGCTGAACCAGGANM_001033694.260
FASF: AAGATCCCGGAAAGCAAGATR: TGATACCAGCACTGGAGCAGNM_139194.392
ACC1F: CCCAACAGAATAAAGCTACTCTGGR: TCCTTTTGTGCAACTAGGAACGT>NM_022193.170
GAPDHF: AAGGTCATCCATGACAACTTTGR: GTCCACCACCCTGTTGCTGTAGNM_017008.4496
β-actinR: CCACCATGTACCCAGGCATTF: CGGACTCATCGTACTCCTGCNM_031144189

Effect of casein and soy protein on lipid profile parameters (mg/dL) in Rvs-treated hypercholesterolemic rats

GroupsCholTriGLDL-CholHDL-Chol
Note: Within each column, means superscripts with different letters are significantly different (P < 0.05).
Control120.85 ± 1.13a284.12 ± 2.52a42.57 ± 0.91a46.41 ± 1.43a
Chol167.02 ± 2.94b358.85 ± 4.16b79.76 ± 5.03b29.98 ± 0.27b
Casein115.97 ± 5.54ac281.19 ± 2.05a40.68 ± 0.33a49.69 ± 0.32c
Soy109.34 ± 2.53c280.78 ±.4.19a41.07 ± 0.64a47.54 ± 1.47a
Chol + Rvs144.02 ± 4.17d328.82 ± 1.67c61.69 ± 0.93c37.98 ± 0.93d
Chol + Rvs + Casein139.17 ± 1.33e313.08 ± 4.46e58.19 ± 1.14cd39.42 ± 1.52de
Chol + Rvs + Soy129.88 ± 3.22f298.06 ± 1.42f47.75 ± 0.59e40.50 ± 0.44e

Effect of soy protein or casein on serum biochemical parameters in Rvs-treated hypercholesterolemic rats

GroupsALT (U/L)AST (U/L)TP (g/dL)Urea (mg/dL)Creatinine (mg/dL)
Note: Within each column, means superscripts with different letters are significantly different (P < 0.05).
Control17.67 ± 0.33a56.33 ± 0.88a6.48 ± 0.21a26.53 ± 0.75a0.98 ± 0.15a
Chol25.67 ± 1.20b63.33 ± 0.88b4.73 ± 0.23b37.77 ± 1.76b2.63 ± 0.18b
Casein18.00 ± 0.58a57.67 ± 0.88a6.27 ± 0.35a28.30 ± 0.84a0.84 ± 0.03c
Soy18.33 ± 1.20a55.33 ± 1.45a6.85 ± 0.29c28.47 ± 1.39a0.92 ± 0.03ad
Chol + Rvs43.00 ± 1.15c65.33 ± 1.20b4.30 ± 0.06bd46.43 ± 0.84c3.69 ± 0.10e
Chol + Rvs + Casein34.33 ± 0.88d52.00 ± 0.58c6.88 ± 0.21c36.37 ± 0.80b2.98 ± 0.08bf
Chol + Rvs + Soy22.00 ± 1.15e50.33 ± 1.20cd6.79 ± 0.29ce26.90 ± 1.49a2.23 ± 0.04g

Effect casein and soy protein on hepatic and renal No and MDA in Rvs-treated hypercholesterolemic rats

GroupsNO (µmol/g tissue)MDA (nmol/g tissue)
LiverKidneyLiverKidney
Note: Within each column for each organ, means superscripts with different letters are significantly different (P < 0.05).
Control117.68 ± 2.30a116.43 ± 0.64a132.69 ± 1.48a70.85 ± 1.93a
Chol139.70 ± 0.91b131.30 ± 1.11b151.28 ± 9.34b122.40 ± 5.92b
Casein103.07 ± 5.61c109.46 ± 0.69c126.58 ± 9.93c71.05 ± 1.62a
Soy111.63 ± 1.86d105.65 ± 0.90d96.28 ± 0.98d65.47 ± 2.15c
Chol + Rvs155.75 ± 1.80e152.12 ± 4.04e176.88 ± 6.69e126.71 ± 1.58d
Chol + Rvs + Casein136.36 ±1.20f116.04 ± 0.82a91.61 ± 1.38f74.28 ± 1.93e
Chol + Rvs + Soy121.04 ± 0.85g107.71 ± 0.90cd80.10 ± 1.13g72.27 ± 4.46a

Effect of casein and soy protein on hepatic and renal antioxidant enzymes in Rvs-treated hypercholesterolemic rats

GroupsGPX (U/mg tissue)CAT (U/g tissue)
LiverKidneyLiverKidney
Note: Within each column for each organ, means superscripts with different letters are significantly different (P < 0.05).
Control322.54 ± 3.49a232.09 ± 3.84a91.50 ±2.80a86.12 ± 0.25a
Chol188.73 ± 5.70b116.75 ± 2.63b73.15 ± 0.59b62.37 ± 0.65b
Casein351.16 ± 4.25c241.01 ± 0.86c91.30 ± 4.45a114.15 ± 0.64c
Soy342.61 ± 5.48d241.72 ± 1.72c91.90 ± 1.22a122.13 ± 1.32d
Chol + Rvs171.42 ± 3.18e108.93 ± 1.11d69.33 ± 1.18bc53.28 ± 1.74e
Chol + Rvs + Casein218.15 ± 2.29f150.35 ± 1.03e81.25 ± 1.30d69.65 ± 1.03f
Chol + Rvs + Soy261.60 ± 1.07g160.99 ± 0.61f90.57 ± 1.51a81.54 ± 1.12g