Eugenol targeting CrtM inhibits the biosynthesis of staphyloxanthin in <i>Staphylococcus aureus</i>

Jiang Chang; Bo Chen; Zeqian Du; Bowen Zhao; Jiahui Li; Ziyi Li; Kannappan Arunachalam; Ting Shi; Dongqing Wei; Chunlei Shi

doi:10.26599/FSHW.2022.9250115

| Sign up

PDF (4.6 MB)

Cite

EndNote(RIS) BibTeX

Collect

Submit Manuscript

Show Outline

Figures (9)

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

Fig. 9

Tables (2)

Table 1

Table 2

Open Access

Eugenol targeting CrtM inhibits the biosynthesis of staphyloxanthin in Staphylococcus aureus

Jiang Chang^{^a}, Bo Chen^{^a}, Zeqian Du^{^b}, Bowen Zhao^{^b}, Jiahui Li^{^a}, Ziyi Li^{^a}, Kannappan Arunachalam^{^a}, Ting Shi^{^b}, Dongqing Wei^{^b}, Chunlei Shi^{^a}()

MOST-USDA Joint Research Center for Food Safety, School of Agriculture and Biology, State Key Laboratory of Microbial Metabolism, Shanghai Jiao Tong University, Shanghai 200240, China

School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China

Peer review under responsibility of Tsinghua University Press.

Show Author Information

Highlights

• Virtual screening was an effective measure to screen staphyloxanthin inhibitor.

• Eugenol inhibited staphyloxanthin biosynthesis without affecting S. aureus growth.

• The resistance of S. aureus to ROS decreased significantly under eugenol treatment.

• Eugenol might mainly target CrtM to block staphyloxanthin production.

Abstract

Staphylococcus aureus is a serious foodborne pathogen threatening food safety and public health. Especially the emergence of methicillin-resistant Staphylococcus aureus (MRSA) increased the diff iculty of S. aureus treatment. Staphyloxanthin is a crucial virulence factor of S. aureus. Blocking staphyloxanthin production could help the host immune system counteract the invading S. aureus cells. In this study, we first screened for staphyloxanthin inhibitors using a virtual screening method. The outcome of the virtual screening method resulted in the identification of eugenol (300 μg/mL), which significantly inhibits the staphyloxanthin production in S. aureus ATCC 29213, S. aureus Newman, MRSA ATCC 43300 and MRSA ATCC BAA1717 by 84.2%, 63.5%, 68.1%, and 79.5%, respectively. The outcome of the growth curve assay, f ield-emission scanning electron, and confocal laser scanning microscopy analyses confirmed that eugenol at the test concentration did not affect the morphology and growth of S. aureus. Moreover, the survival rate of S. aureus ATCC 29213 and MRSA ATCC 43300 under H₂O₂ pressure decreased to 51.9% and 45.5% in the presence of eugenol, respectively. The quantitative RT-PCR and molecular simulation studies revealed that eugenol targets staphyloxanthin biosynthesis by downregulating the transcription of the crtM gene and inhibiting the activity of the CrtM enzyme. Taken together, we first determined that eugenol was a prominent compound for staphyloxanthin inhibitor to combat S. aureus especially MRSA infections.

Keywords

Staphylococcus aureusStaphyloxanthin Eugenol Virtual screening 4,4’-Diapophytoene synthase (CrtM)

Electronic Supplementary Material

Download File(s)

fshw-13-3-1368_ESM.docx (481.7 KB)

References

[1]

C.M. Liu, Y. Shen, M. Yang, et al., Hazard of staphylococcal enterotoxins in food and promising strategies for natural products against virulence, J. Agric. Food Chem. 70 (2022) 2450-2465. https://doi.org/10.1021/acs.jafc.1c06773.

Genes	Forward primer (5’-3’)	Reverse primer (5’-3’)
crtM	ATCCAGAACCACCCGTTTTT	GCGATGAAGGTATTGGCATT
crtN	GATGAAGCTTTGACGCAACA	TTCGCATGATACGTTTGCTC
crtP	CGTTATTGGTGGTGGCTTAG	CGCCATTGATGTGGCAAACG
crtQ	CTATGGCGTGTGGTGCATTG	CATCTGTCGATCCGTCATTC
gyrB	GGTGCTGGGCAAATACAAGT	TCCCACACTAAATGGTGCAA

No.	Ligand	RMSD	Docking score	Ligand efficiency	Amino acid residues
1	Auraptene	0.6	–9.363	–0.426	Ala134, Val137, Gly138, Leu141, Thr142, Leu145, Phe233, Ala157, Leu160, Gly161, Gln165, Asn168
2	Naringenin	0.6	–9.048	–0.452	Phe22, Phe26, Tyr41, Asp48, Leu145, Ala157, Leu160, Gly161, Leu164, Gln165, Asn168, Tyr248
3	Morin	0.6	–8.868	–0.403	Phe26, Tyr41, Cys44, Arg45, Ala134, Leu160, Gly161, Leu164, Gln165
4	Osthole	0.6	–8.522	–0.475	Met15, Phe22, Phe26, Val37, Tyr41, Ala134, Gly135, Val137, Gly138, Ala157, Leu160, Gly161, Leu164
5	Menthol	0.6	–7.712	–0.701	Met15, Phe22, Phe26, Tyr41, Ala134, Val137, Gly138, Leu141, Leu145
6	Arachidic acid	0.4	–7.646	–0.348	Phe22, Tyr129, Val133, Ala134, Val137, Gly138, Leu141, Tyr142, Leu145, Gln165, Asn168, Glu176
7	Eugenol	0.6	–7.443	–0.620	Met15, Phe22, Phe26, Val37, Ala134, Gly135, Val137, Ala244
8	Cinnamaldehyde	0.4	–6.381	–0.638	Phe22, Val137, Gly138, Leu164, Gln165, Asn168
9	Thymoquinone	0.4	–6.361	–0.530	Phe22, Phe26, Val137, Gly138, Leu141, Leu145, Ile241, Ala244
10	Terpineol	0.4	–6.067	–0.552	Met15, Phe22, Val37, Tyr41, Leu145, Ile241
11	Linaloo	l0.6	–5.056	–0.460	Gly138, Leu141, Thr142, Leu145, Val156, Ala157, Leu160, Gly161