Home Food Science and Human Wellness Article
PDF (1.1 MB)
Cite
EndNote(RIS) BibTeX
Collect
Submit Manuscript
Show Outline
Figures (7)

Tables (2)
Table 1
Table 2
Open Access

Polysaccharide-rich extract of Potentilla anserina ameliorates nonalcoholic fatty liver disease in free fatty acid-induced HepG2 cells and high-fat/sugar diet-fed mice

Xiujun Lina, Yimei Zhenga,b, Yingying Yanc, Hongting Denga, Shunxin Wanga, Yuanju Hea, Yuting Tianb(), Wenhui Zhangc(), Hui Tenga()
Guangdong Provincial Key Laboratory of Aquatic Product Processing and Safety, Guangdong Province Engineering Laboratory for Marine Biological Products, Guangdong Provincial Engineering Technology Research Center of Seafood, Key Laboratory of Advanced Processing of Aquatic Product of Guangdong Higher Education Institution, College of Food Science and Technology, Guangdong Ocean University, Zhanjiang 524088, China
College of Food Science, Fujian Agriculture and Forestry University, Fuzhou 350002, China
Institute of Agricultural Products Processing & Food Science, Tibet Academy of Agricultural and Animal Husbandry Sciences, Lhasa 850002, China

Peer review under responsibility of Tsinghua University Press.

Show Author Information

Abstract

Potentilla anserina L. (PA) belongs to the Rosaceae family, is a common edible plant in the Qinghai-Tibet Plateau areas of China. This study elucidates the mechanism upon which crude polysaccharide of PA (PAP) on fat accumulation in HepG2 cells stimulated by oleic acid (OA) and high fat high sugar induced mice. The result revealed that PAP inhibited lipid accumulation in obese mice and ameliorated the degree of damage in OA-induced HepG2 cells. Specifically, compared to the control group, the TG and TC levels were decreased in cells and mice serum, the aspartate transaminase and alamine aminotransferase contents were declined in liver of obese mice by PAP treatment. The expressions of adipogenic genes of SREBP-1c, C/EBPα, PPARγ, and FAS were inhibited after PAP treatment. Moreover, PAP increased the mRNA levels of CPT-1 and PPARα, which were involved in fatty acid oxidation. The present results indicated the PAP could alleviate the damage of liver associated with obesity and PAP treatment might provide a dietary therapeutic option for the treatment of hyperlipidemia.

Keywords

Potentilla anserina L.Non-alcoholic fatty liver diseaseLipid accumulationHepG2 cellsHigh fat diet

References

[1]

N.L. Gluchowski, B. Michel, T.C. Walther, et al., Lipid droplets and liver disease: from basic biology to clinical implications, Nat. Rev. Gastro. Hepat. 14 (2017) 343-355. https://doi.org/10.1038/nrgastro.2017.32.

Crossref Google Scholar
[2]

G.A. Michelotti, M.V. Machado, A.M. Diehl, NAFLD, NASH and liver cancer, Nat. Rev. Gastro. Hepat. 10 (2013) 656-665. https://doi.org/10.1038/nrgastro.2013.183.

Crossref Google Scholar
[3]

S.A. Parry, L. Hodson, Managing NAFLD in type 2 diabetes: the effect of lifestyle interventions, a narrative review, Adv. Ther. 37 (2020) 1381-1406. https://doi.org/10.1007/s12325-020-01281-6.

Crossref Google Scholar
[4]

U. Iqbal, B.J. Perumpail, N. John, et al., Judicious use of lipid lowering agents in the management of NAFLD, Diseases 6 (2018) 87. https://doi.org/10.3390/diseases6040087.

Crossref Google Scholar
[5]

J.R. Chen, Z.Q. Yang, T.J. Hu, et al., Immunomodulatory activity in vitro and in vivo of polysaccharide from Potentilla anserina, Fitoterapia 81 (2010) 1117-1124. https://doi.org/10.1016/j.fitote.2010.07.009.c.

Crossref Google Scholar
[6]

P.H. Guo, C. Hong, J.P. Ma, et al., Enzyme-assisted extraction, characterization, and in vitro antioxidant activity of polysaccharides from Potentilla anserina L, Front. Nutr. 10 (2023) 1216572. https://doi.org/10.3389/fnut.2023.1216572.

Crossref Google Scholar
[7]

G.T. Min, Protective mechanism of Potentilla anserina polysaccharide on mice with D-galactosamine-induced acute liver injury, Academic Journal of Second Military Medical University (2016) 916-919. https://doi.org/10.16781/j.0258-879x.2016.07.0916.

Crossref Google Scholar
[8]

T. Morikawa, K. Ninomiya, K. Imura, et al., Hepatoprotective triterpenes from traditional Tibetan medicine Potentilla anserina, Phytochemistry 102 (2014) 169-181. https://doi.org/10.1016/j.phytochem.2014.03.002.

Crossref Google Scholar
[9]

X. Qin, L. Li, Q. Lv, et al., Underlying mechanism of protection from hypoxic injury seen with n-butanol extract of Potentilla anserine L. in hippocampal neurons, Neural. Regen. Res. 7 (2012) 2576. https://doi.org/10.3969/j.issn.1673-5374.2012.33.002.

Crossref Google Scholar
[10]

M. Tomczyk, K.P. Latté, Potentilla—a review of its phytochemical and pharmacological profile, J. Ethnopharmacol. 122 (2009) 184-204. https://doi.org/10.1016/j.jep.2008.12.022.

Crossref Google Scholar
[11]

Y.L. Zhao, G.M. Cai, X. Hong, et al., Anti-hepatitis B virus activities of triterpenoid saponin compound from Potentilla anserine L., Phytomedicine 15 (2008) 253-258. https://doi.org/10.1016/j.phymed.2008.01.005.

Crossref Google Scholar
[12]

B. Zhao, J. Zhang, J. Yao, et al., Selenylation modification can enhance antioxidant activity of Potentilla anserina L. polysaccharide, Int. J. Biol. Macromol. 58 (2013) 320-328. https://doi.org/10.1016/j.ijbiomac.2013.04.059.

Crossref Google Scholar
[13]

J. Sun, Q. Ma, L. Wang, et al., Protective effects of aqueous extract of Potentillae discoloris Herba on lipotoxic rat islet cells, Chinese Patent Medicine 6 (2019) 1242-1247. http://dx.chinadoi.cn/10.3969/j.issn.1001-1528.2019.06.009.

Crossref Google Scholar
[14]

J. Wei, Q. Huang, R. Huang, et al., Asiatic acid from Potentilla chinensis attenuate ethanol-induced hepatic injury via suppression of oxidative stress and Kupffer cell activation, Biol. Pharm. Bull. (2013) 1980-1989. https://doi.org/10.1248/bpb.b13-00634.

Crossref Google Scholar
[15]

T. Morikawa, K. Imura, Y. Akagi, et al., Ellagic acid glycosides with hepatoprotective activity from traditional Tibetan medicine Potentilla anserina, J. Nat. Med. 72 (2018) 317-325. https://doi.org/10.1007/s11418-017-1137-y.

Crossref Google Scholar
[16]

Y. Zhang, X. Li, Q. Yang, et al., Antioxidation, anti-hyperlipidaemia and hepatoprotection of polysaccharides from Auricularia auricular residue, Chem-Biol. Interact. 333 (2021) 109323. https://doi.org/10.1016/j.cbi.2020.109323.

Crossref Google Scholar
[17]

M. Dubois, K.A. Gilles, J.K. Hamilton, et al., Colorimetric method for determination of sugars and related substances, Anal. Chem. 28 (1956) 350-356. https://doi.org/10.1021/ac60111a017.

Crossref Google Scholar
[18]

A.A.N. Saqib, P.J. Whitney, Differential behaviour of the dinitrosalicylic acid (DNS) reagent towards mono- and di-saccharide sugars, Biomass Bioenerg. 35 (2011) 4748-4750. https://doi.org/10.1016/j.biombioe.2011.09.013.

Crossref Google Scholar
[19]

N. Blumenkrantz, G.H. Asboe, New method for quantitative determination of uronic acids, Anal. Biochem. 54 (1973) 484-489. https://doi.org/10.1016/0003-2697(73)90377-1.

Crossref Google Scholar
[20]

C. Chen, L.J. You, A.M. Abbasi, et al., Characterization of polysaccharide fractions in mulberry fruit and assessment of their antioxidant and hypoglycemic activities in vitro, Food Funct. 7 (2016) 530-539. https://doi.org/10.1039/C5FO01114K.

Crossref Google Scholar
[21]

M. Zhu, R. Huang, P. Wen, et al., Structural characterization and immunological activity of pectin polysaccharide from kiwano (Cucumis metuliferus) peels, Carbohyd. Polym. 254 (2021) 117371. https://doi.org/10.1016/j.carbpol.2020.117371.

Crossref Google Scholar
[22]

H. Rafiei, K.Omidian, B.Bandy, Dietary polyphenols protect against oleic acid-induced steatosis in an in vitro model of NAFLD by modulating lipid metabolism and improving mitochondrial function, Nutrients 11 (2019) 541. https://doi.org/10.3390/nu11030541.

Crossref Google Scholar
[23]

C.J. Liou, S.J. Wu, L.C. Chen, et al., Acacetin from traditionally used Saussurea involucrata Kar. et Kir. suppressed adipogenesis in 3T3-L1 adipocytes and attenuated lipid accumulation in obese mice, Front. Pharmacol. 8 (2017) 589. https://doi.org/10.3389/fphar.2017.00589.

Crossref Google Scholar
[24]

H.S. Gao, L.L. Ding, R. Liu, et al., Characterization of Anoectochilus roxburghii polysaccharide and its therapeutic effect on type 2 diabetic mice, Int. J. Biol. Macromol. 179 (2021) 259-269. https://doi.org/10.1016/j.ijbiomac.2021.02.217.

Crossref Google Scholar
[25]

Z. Pataky, E.B. Harsch, A. Golay, Open questions about metabolically normal obesity, Int. J. Obesity. 34 (2010) S18-S23. https://doi.org/10.1038/ijo.2010.235.

Crossref Google Scholar
[26]

B.M. Popkin, L.S. Adair, S.W. Ng, Global nutrition transition and the pandemic of obesity in developing countries, Nutr. Rev. 70 (2012) 3-21. https://doi.org/10.1111/j.1753-4887.2011.00456.x.

Crossref Google Scholar
[27]

T.H. Fu, S.J. Wang, J. Liu, et al., Protective effects of α-mangostin against acetaminophen-induced acute liver injury in mice, Eur. J. Pharmacol. 827 (2018) 173-180. https://doi.org/10.1016/j.ejphar.2018.03.002.

Crossref Google Scholar
[28]

C.W. Song, L. Huang, L. Rong, et al., Anti-hyperglycemic effect of Potentilla discolor decoction on obese-diabetic (ob-db) mice and its chemical composition, Fitoterapia 83(8) (2012) 1474-1483. https://doi.org/10.1016/j.fitote.2012.08.013.

Crossref Google Scholar
[29]

P.F. He, A.Q. Zhang, F.M. Zhang, et al., Structure and bioactivity of a polysaccharide containing uronic acid from Polyporus umbellatus sclerotia, Carbohyd. Polym. 152 (2016) 222-230. https://doi.org/10.1016/j.carbpol.2016.07.010.

Crossref Google Scholar
[30]

M.A. Bezerra, D.E. Cohen, Triglyceride metabolism in the liver, Compr. Physiol. 8 (2017) 1. https://doi.org/10.1002/cphy.c170012.

Crossref Google Scholar
[31]

W.Y. Zhang, H. Guan, D.J. Huang, et al., Effects of preheating temperatures on β-lactoglobulin structure and binding interaction with dihydromyricetin, efood 3(5) (2022) e30. https://doi.org/10.1002/efd2.30.

Crossref Google Scholar
[32]

L.Y. Ren, D.M. Sun, X. Zhou, et al., Chronic treatment with the modified Longdan Xiegan Tang attenuates olanzapine-induced fatty liver in rats by regulating hepatic de novo lipogenesis and fatty acid beta-oxidationassociated gene expression mediated by SREBP-1c, PPAR-alpha and AMPK-alpha, J. Ethnopharmacol. 232 (2019) 176-187. https://doi.org/10.1016/j.jep.2018.12.034.

Crossref Google Scholar
[33]

S. Assaf, S. Lagarrigue, S. Daval, et al., Genetic linkage and expression analysis of SREBP and lipogenic genes in fat and lean chicken, Comp. Biochem. Phys. B 137(4) (2004) 433-441. https://doi.org/10.1016/j.cbpc.2004.02.005.

Crossref Google Scholar
[34]

A. Chen, X.Y. Chen, S. Cheng, et al., FTO promotes SREBP1c maturation and enhances CIDEC transcription during lipid accumulation in HepG2 cells, BBA-Biomembranes. 1863(5) (2018) 538-548. https://doi.org/10.1016/j.bbalip.2018.02.003.

Crossref Google Scholar
[35]

Y. Mi, D.H.Tan, Y. He, et al., Melatonin modulates lipid metabolism in HepG2 cells cultured in high concentrations of oleic acid: AMPK pathway activation may play an important role, Cell Biochem. Biophys. 76(4) (2018) 463-470. https://doi.org/10.1007/s12013-018-0859-0.

Crossref Google Scholar
[36]

Y.U. Li, S.Q. Xu, M.M. Mihaylova, et al., AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice, Cell Metab. 13(4) (2011) 376-388. https://doi.org/10.1016/j.cmet.2011.03.009.

Crossref Google Scholar
[37]

Y.H. Choi, J.K. Bae, H.S. Chae, et al., α-Mangostin regulates hepatic steatosis and obesity through SirT1-AMPK and PPARγ pathways in high-fat diet-induced obese mice, J. Agric. Food Chem. 63(38) (2015) 8399-8406. https://doi.org/10.1021/acs.jafc.5b01637.

Crossref Google Scholar
Food Science and Human Wellness
Volume 13 Issue 6,
November 2024
Pages 3351-3360
DOI: 10.26599/FSHW.2023.9250020
Cite this article:
Lin X, Zheng Y, Yan Y, et al. Polysaccharide-rich extract of Potentilla anserina ameliorates nonalcoholic fatty liver disease in free fatty acid-induced HepG2 cells and high-fat/sugar diet-fed mice. Food Science and Human Wellness, 2024, 13(6): 3351-3360. https://doi.org/10.26599/FSHW.2023.9250020
Metrics & Citations  
Article History
Copyright
Rights and Permissions
Return

Primer sequence used for real-time qPCR.

Gene Forward primers (5’ to 3’) Reverse primers (5’ to 3’)
Note: PPARγ, peroxisome proliferator-activated receptor γ; C/EBPα, CCAAT/enhancer binding protein alpha; SREBP-1c, sterol regulatory element binding protein-1c; FAS, fatty acid synthase; CPT-1, carnitine palmitoyltransferase-Ⅰ; PPARα, peroxisome proliferators-activated receptors alpha.
PPARγ TGCAGGTGATCAAGAAGACG AGTGCAACTGGAAGAAGGGA
C/EBPα TGGACAAGAACAGCAACGAGTA ATTGTCACTGGTCAGCTCCAG
SREBP-1c GCGCCTTGACAGGTGAAGTC GCCAGGGAAGTCACTGTCTTG
HepG2 cell FAS CCCCTGATGAAGAAGGATCA ACTCCACAGGTGGGAACAAG
CPT-1 CCTCCGTAGCTGACTCGGTA GGAGTGACCGTGAACTGAAA
PPARα ACGATTCGACTCAAGCTGGT GTTGTGTGACATCCCGACAG
β-Actin CTCTTCCAGCCTTCCTTCCT AGCACTGTGTTGGCGTACAG
PPARγ CAGGAGAGCAGGGATTTGCA CCTACGCTCAGCCCTCTTCAT
C/EBPα TTACAACAGGCCAGGTTTCC GGCTGGCGACATACAGTACA
SREBP-1c ATCGCAAACAAGCTGACCTG AGATCCAGGTTTGAGGTGGG
Animal’s liver FAS TTGCTGGCACTACAGAATGC AACAGCCTCAGAGCGACAAT
CPT-1 CTCAGTGGGAGCGACTCTTCA GGCCTCTGTGGTACACGACAA
PPARα CAGGAGAGCAGGGATTTGCA CCTACGCTCAGCCCTCTTCAT
β-Actin CTGTCCCTGTATGCCTCTG ATGTCACGCACGATTTCC

Effects on blood and hepatic parameters in HFD-fed mice receiving 6 weeks of treatments.

Parameter Normal Model PAP Positive
Note: Data represent means ± SEM (n ≥ 6 for per group). ###P < 0.001 compared to normal group. ***P < 0.001, **P < 0.01, *P < 0.05 compared to the model group.
Serum biochemical assays
TC (mmol/L) 2.47 ± 0.46 5.18 ± 0.67### 3.76 ± 0.53*** 3.80 ± 0.54***
TG (mmol/L) 1.23 ± 0.06 2.15 ± 0.29### 1.28 ± 0.13*** 1.32 ± 0.11***
LDL-c (mmol/L) 0.53 ± 0.07 1.65 ± 0.14### 1.11 ± 0.16*** 1.08 ± 0.17***
HDL-c (mmol/L) 1.13 ± 0.08 0.45 ± 0.08### 0.77 ± 0.12*** 0.68 ± 0.10***
FFA (μg/μL) 96.52 ± 7.98 167.61± 14.31### 122.18± 11.29*** 121.82± 14.74***
FBG (mmol/L) 5.78 ± 0.83 8.41 ± 1.21### 7.26 ± 0.93** 7.24 ± 1.14**
FSI (mIU/L) 14.18 ± 3.11 28.51± 4.56### 22.73± 4.03*** 23.68± 3.62***
HOMA-IR 3.64 ± 0.41 10.66± 0.86### 7.33 ± 0.77*** 7.62 ± 0.67***
Hepatic parameters
AST (U/L) 20.09 ± 2.18 49.01± 5.42### 35.90± 4.66*** 38.17± 5.38***
ALT (U/L) 26.53 ± 3.01 57.89± 7.12### 33.60± 4.13*** 35.48± 4.69***
MDA (nmol/g) 32.18 ± 4.42 56.18± 6.61### 43.84± 4.35*** 42.18± 6.44***
SOD (μg/mL) 40.33 ± 6.06 32.15± 5.18### 36.08± 5.02*** 34.32 ± 4.18**
CAT (ng/mL) 28.63 ± 4.37 21.56± 3.74### 24.97 ± 3.06** 25.08± 5.06***
GPx (μg/mL) 13.83 ± 1.04 9.05 ± 3.16### 10.87 ± 1.94 11.34 ± 3.21*