Home Food Science and Human Wellness Article
PDF (7.3 MB)
Cite
EndNote(RIS) BibTeX
Collect
Submit Manuscript
Show Outline
Figures (6)

Tables (1)
Table 1
Open Access

Lacticaseibacillus paracasei K56 inhibits lipid accumulation in adipocytes by promoting lipolysis

Silu Wanga,1, Jinxing Lia,1, Wei-Hsien Liub, Niya Lia, Huijing Lianga, Weilian Hungb, Qiuyue Jiangb, Ruyue Chenga, Xi Shena(), Fang Hea()
Department of Nutrition and Food Hygiene, West China School of Public Health and West China Fourth Hospital, Sichuan University, Chengdu 610041, China
Inner Mongolia Yili Industrial Group Co., Ltd., Hohhot 010110, China

Peer review under responsibility of Tsinghua University Press.

1 These authors contributed equally to this work.

Show Author Information

Abstract

Probiotics crosstalk immunity to improve host glycolipid metabolism, which is a new strategy for obesity. This study aimed to explore the functions of Lacticaseibacillus paracasei K56 (K56), in regulating the lipid metabolism of adipocytes and its immune regulation mechanisms. We co-cultured RAW264.7 macrophages with K56, and the K56-stimulated RAW264.7-conditioned medium (K56-CM) was collected and treated with 3T3-L1 pre-adipocytes. The expression of lipid metabolism-related markers of adipocytes, and the content of cytokines in CMs were detected. The results demonstrated that K56-CM promoted the expression of peroxisome proliferator-activated receptor-γ (PPAR-γ), CCAAT/enhancer binding protein α (C/EBPα), and other adipogenesis-related markers, which resulted in the upregulation of lipolysis markers, such as hormone-sensitive lipase (HSL), adipose triglyceride lipase (ATGL). The activation of lipolysis enhanced the expression of fatty acid β-oxidation-related and mitochondrial biogenesis-related markers and reduced lipid accumulation in adipocytes. The glycolipid metabolism pattern of K56 may be due to its immunomodulatory characteristics, which stimulated macrophages to secrete fewer TNF-α, thereby promoting the expression of lipolysis-related markers, and TNF-α synergized with lipase to promote lipolysis. It has not been reported that L. paracasei modulated lipid metabolism via the lipolysis pathway, which suggested that K56 may regulate glycolipid metabolism of the host by maintaining immune homeostasis.

Keywords

ObesityLacticaseibacillusMacrophageAdipocyteLipolysis

References

[1]

A. Afshin, M.H. Forouzanfar, M.B. Reitsma, et al., Health effects of overweight and obesity in 195 countries over 25 Years, N. Engl. J. Med. 377 (2017) 13-27. https://doi.org/10.1056/NEJMoa1614362.

Crossref Google Scholar
[2]
World Health Organization. Obesity data and statistics. http://www.euro.who.int/en/health-topics/noncommunicable-diseases/obesity/data-and-statistics.
[3]

G.P. Püschel, J. Klauder, J. Henkel, Macrophages, low-grade inflammation, insulin resistance and hyperinsulinemia: a mutual ambiguous relationship in the development of metabolic diseases, J. Clin. Med. 11 (2022). https://doi.org/10.3390/jcm11154358.

Crossref Google Scholar
[4]

M. An, Y.H. Park, Y.H. Lim, Antiobesity and antidiabetic effects of the dairy bacterium Propionibacterium freudenreichii MJ2 in high-fat diet-induced obese mice by modulating lipid metabolism, Sci. Rep. 11 (2021) 2481. https://doi.org/10.1038/s41598-021-82282-5.

Crossref Google Scholar
[5]

M.S. Rahman, I. Kang, Y. Lee, et.al., Bifidobacterium longum subsp. infantis YB0411 inhibits adipogenesis in 3T3-L1 pre-adipocytes and reduces high-fat-diet-induced obesity in mice, J. Agric. Food Chem. 69 (2021) 6032-6042. https://doi.org/10.1021/acs.jafc.1c01440

Crossref Google Scholar
[6]

K.J. Han, N.K. Lee, H.S. Yu, et.al., Anti-adipogenic effects of the probiotic Lactiplantibacillus plantarum KU15117 on 3T3-L1 adipocytes, Probiotics Antimicro. 14 (2022) 501-509. https://doi.org/10.1007/s12602-021-09818-z.

Crossref Google Scholar
[7]

S. Kim, S.I. Choi, M. Jang, et.al., Anti-adipogenic effect of Lactobacillus fermentum MG4231 and MG4244 through AMPK pathway in 3T3-L1 preadipocytes, Food. Sci. Biotechnol. 29 (2020) 1541-1551. https://doi.org/10.1007/s10068-020-00819-2.

Crossref Google Scholar
[8]

H. Lu, W. Zhao, W.H. Liu, et.al., Safety evaluation of Bifidobacterium lactis BL-99 and Lacticaseibacillus paracasei K56 and ET-22 in vitro and in vivo, Front. Microbiol. 12 (2021) 686541. https://doi.org/10.3389/fmicb.2021.686541.

Crossref Google Scholar
[9]

Q.Q. Min, T. Sun, J.Y. Xu, et al., Differential modulation of the metabolic effects of diet-induced obesity by probiotic Lactobacillus paracasei K56 and prebiotic α-galactooligosaccharides, Curr. Top. Nutraceut. R. 19 (2020) 21-28. https://doi.org/10.37290/ctnr2641-452X.19:21-28.

Crossref Google Scholar
[10]

Z. Miao, H. Zheng, W.H. Liu, et al., Lacticaseibacillus paracasei K56 attenuates high-fat diet-induced obesity by modulating the gut microbiota in mice, Probiotics Antimicro. 15 (2023) 844-855. https://doi.org/10.1007/s12602-022-09911-x.

Crossref Google Scholar
[11]

S. Khan, H. Luck, S. Winer, et al., Emerging concepts in intestinal immune control of obesity-related metabolic disease, Nat. Commun. 12 (2021) 2598. https://doi.org/10.1038/s41467-021-22727-7.

Crossref Google Scholar
[12]

D.A. Winer, H. Luck, S. Tsai, et al., The intestinal immune system in obesity and insulin resistance, Cell Metab. 23 (2016) 413-426. https://doi.org/10.1016/j.cmet.2016.01.003.

Crossref Google Scholar
[13]

C. Peng, J. Li, Z. Miao, et al., Early life administration of Bifidobacterium bifidum BD-1 alleviates long-term colitis by remodeling the gut microbiota and promoting intestinal barrier development, Front. Microbiol. 13 (2022) 916824. https://doi.org/10.3389/fmicb.2022.916824.

Crossref Google Scholar
[14]

S. Wang, C. Peng, J. Li, et al., Protective effect and mechanism of Bifidobacterium bifidum TMC3115 on long-term colitis in mice which exposed to antibiotic in early life, Wei Sheng Yan Jiu 51 (2022) 624-644. https://doi.org/10.19813/j.cnki.weishengyanjiu.2022.04.021.

Crossref Google Scholar
[15]

G.P. Püschel, J. Klauder, J. Henkel, Macrophages, low-grade inflammation, insulin resistance and hyperinsulinemia: a mutual ambiguous relationship in the development of metabolic diseases, J. Clin. Med. 11 (2022). https://doi.org/10.3390/jcm11154358.

Crossref Google Scholar
[16]

S.P. Weisberg, D. McCann, M. Desai, et al., Obesity is associated with macrophage accumulation in adipose tissue, J. Clin. Invest. 112 (2003) 1796-1808. https://doi.org/10.1172/jci19246.

Crossref Google Scholar
[17]

A.A. Herrada, A. Olate-Briones, A. Rojas, et al., Adipose tissue macrophages as a therapeutic target in obesity-associated diseases, Obes. Rev. 22 (2021) e13200. https://doi.org/10.1111/obr.13200.

Crossref Google Scholar
[18]

L. Shi, M. Li, K. Miyazawa, et al., Effects of heat-inactivated Lactobacillus gasseri TMC0356 on metabolic characteristics and immunity of rats with the metabolic syndrome, Br. J. Nutr. 109 (2013) 263-272. https://doi.org/10.1017/s000711451200116x.

Crossref Google Scholar
[19]

X. Kang, H. Liang, Y. Luo, et al., Streptococcus thermophilus MN-ZLW-002 can inhibit pre-adipocyte differentiation through macrophage activation, Biol. Pharm. Bull. 44 (2021) 316-324. https://doi.org/10.1248/bpb.b20-00335.

Crossref Google Scholar
[20]

K. Miyazawa, F. He, K. Yoda, et al., Potent effects of, and mechanisms for, modification of crosstalk between macrophages and adipocytes by lactobacilli, Microbiol. Immunol. 56 (2012) 847-854. https://doi.org/10.1111/j.1348-0421.2012.00512.x.

Crossref Google Scholar
[21]

F. Joint, WHO working group report on drafting guidelines for the evaluation of probiotics in food, London, Ontario, Canada 30 (2002) 16-22.

Google Scholar
[22]

A. Di Cerbo, B. Palmieri, Lactobacillus paracasei subsp. Paracasei F19; a farmacogenomic and clinical update, Nutr. Hosp. 28 (2013) 1842-1850.

Google Scholar
[23]

H. Suzuki, T. Yamazaki, K. Ohshio, et al., A specific strain of lactic acid bacteria, Lactobacillus paracasei, inhibits inflammasome activation in vitro and prevents inflammation-related disorders, J. Immunol. 205 (2020) 811-821. https://doi.org/10.4049/jimmunol.1900657.

Crossref Google Scholar
[24]

S. Lee, R. Kirkland, Z.I. Grunewald, et al., Beneficial effects of non-encapsulated or encapsulated probiotic supplementation on microbiota composition, intestinal barrier functions, inflammatory profiles, and glucose tolerance in high fat fed rats, Nutrients 11 (2019). https://doi.org/10.3390/nu11091975.

Crossref Google Scholar
[25]

G. Frühbeck, Overview of adipose tissue and its role in obesity and metabolic disorders, Methods Mol. Biol. 456 (2008) 1-22. https://doi.org/10.1007/978-1-59745-245-8_1.

Crossref Google Scholar
[26]

S. Kersten, Mechanisms of nutritional and hormonal regulation of lipogenesis, EMBO Rep. 2 (2001) 282-286. https://doi.org/10.1093/embo-reports/kve071.

Crossref Google Scholar
[27]

E.D. Rosen, O.A. MacDougald, Adipocyte differentiation from the inside out, Nat. Rev. Mol. Cell Biol. 7 (2006) 885-896. https://doi.org/10.1038/nrm2066.

Crossref Google Scholar
[28]

J.K. Sethi, G.S. Hotamisligil, The role of TNFα in adipocyte metabolism, Semin. Cell Dev. Biol. 10 (1999) 19-29. https://doi.org/10.1006/scdb.1998.0273.

Crossref Google Scholar
[29]

M. Hossain, D.S. Park, M.S. Rahman, et al., Bifidobacterium longum DS0956 and Lactobacillus rhamnosus DS0508 culture-supernatant ameliorate obesity by inducing thermogenesis in obese-mice, Benef. Microbes 11 (2020) 361-373. https://doi.org/10.3920/bm2019.0179.

Crossref Google Scholar
[30]

D. Kratky, S. Obrowsky, D. Kolb, et al., Pleiotropic regulation of mitochondrial function by adipose triglyceride lipase-mediated lipolysis, Biochimie. 96 (2014) 106-112. https://doi.org/10.1016/j.biochi.2013.06.023.

Crossref Google Scholar
[31]

C. Sztalryd, G. Xu, H. Dorward, et al., Perilipin A is essential for the translocation of hormone-sensitive lipase during lipolytic activation, J. Cell Biol. 161 (2003) 1093-1103. https://doi.org/10.1083/jcb.200210169.

Crossref Google Scholar
[32]

S. Lobo, B.M. Wiczer, D.A. Bernlohr, Functional analysis of long-chain acyl-CoA synthetase 1 in 3T3-L1 adipocytes, J. Biol. Chem. 284 (2009) 18347-18356. https://doi.org/10.1074/jbc.M109.017244.

Crossref Google Scholar
[33]

F. Ouali, F. Djouadi, C. Merlet-Bénichou, et al., Regulation of fatty acid transport protein and mitochondrial and peroxisomal β-oxidation gene expression by fatty acids in developing rats, Pediatr. Res. 48 (2000) 691-696. https://doi.org/10.1203/00006450-200011000-00023.

Crossref Google Scholar
[34]

M. Kim, K. Park, I. Choi, The metabolic suppressor 3-iodothyronamine enhances lipolysis in 3T3-L1 adipocytes via activation of the adenosine monophosphate-activated protein kinase/forkhead box O1 signaling pathway, J. Physiol. Pharmacol. 71 (2020) 409-416. https://doi.org/10.26402/jpp.2020.3.12.

Crossref Google Scholar
[35]

J. Lone, H.A. Parray, J.W. Yun, Nobiletin induces brown adipocyte-like phenotype and ameliorates stress in 3T3-L1 adipocytes, Biochimie 146 (2018) 97-104. https://doi.org/10.1016/j.biochi.2017.11.021.

Crossref Google Scholar
[36]

D. Pitocco, M. Di Leo, L. Tartaglione, et al., The role of gut microbiota in mediating obesity and diabetes mellitus, Eur. Rev. Med. Pharmacol. Sci. 24 (2020) 1548-1562. https://doi.org/10.26355/eurrev_202002_20213.

Crossref Google Scholar
[37]

R. Burcelin, Gut microbiota and immune crosstalk in metabolic disease, Mol. Metab. 5 (2016) 771-781. https://doi.org/10.1016/j.molmet.2016.05.016.

Crossref Google Scholar
[38]

C.C. Bain, A. Schridde, Origin, differentiation, and function of intestinal macrophages, Front. Immunol. 9 (2018) 2733. https://doi.org/10.3389/fimmu.2018.02733.

Crossref Google Scholar
[39]

A. Shapouri-Moghaddam, S. Mohammadian, H. Vazini, et al., Macrophage plasticity, polarization, and function in health and disease, J. Cell Physiol. 233 (2018) 6425-6440. https://doi.org/10.1002/jcp.26429.

Crossref Google Scholar
[40]

V. Veckman, M. Miettinen, S. Matikainen, et al., Lactobacilli and Streptococci induce inflammatory chemokine production in human macrophages that stimulates Th1 cell chemotaxis, J. Leukoc Biol. 74 (2003) 395-402. https://doi.org/10.1189/jlb.0402212.

Crossref Google Scholar
[41]

B. Wang, Y. Wu, R. Liu, et al., Lactobacillus rhamnosus GG promotes M1 polarization in murine bone marrow-derived macrophages by activating TLR2/MyD88/MAPK signaling pathway, Anim. Sci. J. 91 (2020) e13439. https://doi.org/10.1111/asj.13439.

Crossref Google Scholar
[42]

L.M. Rocha-Ramírez, R.A. Pérez-Solano, S.L. Castañón-Alonso, et al., Probiotic Lactobacillus strains stimulate the inflammatory response and activate human macrophages, J. Immunol. Res. 2017 (2017) 4607491. https://doi.org/10.1155/2017/4607491.

Crossref Google Scholar
[43]

H. Morita, F. He, T. Fuse, et al., Cytokine production by the murine macrophage cell line J774.1 after exposure to lactobacilli, Biosci. Biotechnol. Biochem. 66 (2002) 1963-1966. https://doi.org/10.1271/bbb.66.1963.

Crossref Google Scholar
[44]

D.H. Han, W.K. Kim, S. Park, et al., Lactobacillus paracasei treatment modulates mRNA expression in macrophages, Biochem. Biophys Rep. 23 (2020) 100788. https://doi.org/10.1016/j.bbrep.2020.100788.

Crossref Google Scholar
[45]

I.K. Hyun, J.S. Lee, J.W. Yoon, et al., Skimmed milk fermented by lactic acid bacteria inhibits adipogenesis in 3T3-L1 pre-adipocytes by downregulating PPARγ via TNF-α induction in vitro, Food Funct. 12 (2021) 8605-8614. https://doi.org/10.1039/d1fo00076d.

Crossref Google Scholar
[46]

W.P. Cawthorn, J.K. Sethi, TNF-alpha and adipocyte biology, FEBS Lett. 582 (2008) 117-131. https://doi.org/10.1016/j.febslet.2007.11.051.

Crossref Google Scholar
[47]

S. Ranjit, E. Boutet, P. Gandhi, et al., Regulation of fat specific protein 27 by isoproterenol and TNF-α to control lipolysis in murine adipocytes, J. Lipid Res. 52 (2011) 221-236. https://doi.org/10.1194/jlr.M008771.

Crossref Google Scholar
[48]

T. Kawai, S. Akira, The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors, Nat. Immunol. 11 (2010) 373-384. https://doi.org/10.1038/ni.1863.

Crossref Google Scholar
[49]

A.L. Li, Y.Q. Sun, P. Du, et al., The effect of Lactobacillus actobacillus peptidoglycan on bovine β-lactoglobulin-sensitized mice via TLR2/NF-κB pathway, Iran J. Allergy Asthma. 16 (2017) 147-158.

Google Scholar
[50]

H. Liang, Z. Luo, Z. Miao, et al., Lactobacilli and bifidobacteria derived from infant intestines may activate macrophages and lead to different IL-10 secretion, Biosci. Biotechnol. Biochem. 84 (2020) 2558-2568. https://doi.org/10.1080/09168451.2020.1811948.

Crossref Google Scholar
[51]

Z. Wu, D. Pan, Y. Guo, et al., Peptidoglycan diversity and anti-inflammatory capacity in Lactobacillus strains, Carbohydr. Polym. 128 (2015) 130-137. https://doi.org/10.1016/j.carbpol.2015.04.026.

Crossref Google Scholar
[52]

S.R. Qi, Y.J. Cui, J.X. Liu, et al., Lactobacillus rhamnosus GG components, SLP, gDNA and CpG, exert protective effects on mouse macrophages upon lipopolysaccharide challenge, Lett. Appl. Microbiol. 70 (2020) 118-127. https://doi.org/10.1111/lam.13255.

Crossref Google Scholar
Food Science and Human Wellness
Volume 13 Issue 6,
November 2024
Pages 3511-3521
DOI: 10.26599/FSHW.2023.9250034
Cite this article:
Wang S, Li J, Liu W-H, et al. Lacticaseibacillus paracasei K56 inhibits lipid accumulation in adipocytes by promoting lipolysis. Food Science and Human Wellness, 2024, 13(6): 3511-3521. https://doi.org/10.26599/FSHW.2023.9250034
Metrics & Citations  
Article History
Copyright
Rights and Permissions
Return

The primer sequence used for quantitative RT-PCR.

Gene Forward (5’-3’) Reverse (5’-3’)
β-actin CAGCCTTCCTTCTTGGGTATGGA AGAGGTCTTTACGGATGTCAACG
TNF-α GCCTATGTCTCAGCCTCTTCTC GGTCTGGGCCATAGAACTGAT
IL-6 GGACTGATGCTGGTGACAAC CAGGTCTGTTGGGAGTGGTAT
IL-10 CAGTACAGCCGGGAAGACAAT TTGTCCAGCTGGTCCTTTGT
IL-1β CCCAGGGCATGTTAAGGAGC TTCTTGTGACCCTGAGCGAC
IL-12 CTCTGTCTGCAGAGAAGGTC GCTGGTGCTGTAGTTCTCAT
PPAR-γ TGGAGCCTAAGTTTGAGTTTGC ATGTCCTCGATGGGCTTCAC
C/EBP-α AATGGCAGTGTGCACGTCTA CCCAGCCGTTAGTGAAGAGT
aP-2 CGATGAAATCACCGCAGACG CCAGCTTGTCACCATCTCGT
SREBP-1 CACTTCTGGAGACATCGCAAAC TGGTAGACAACAGCCGCATC
FAS CTGCCTTCGGTTCAGTCTCTT CAGAATGGCACACCCTCCAA
ACC CAAGTGCTCAAGTTTGGCGC CAAGAACCACCCCGAAGCTC
SCD1 ATGGATATCGCCCCTACGAC GATGTGCCAGCGGTACTCAC
HSL TGCTCTTCTTCGAGGGTGAT GATGGCAGGTGTGAACTGG
ATGL CAACGCCACTCACATCTACGG GGACACCTCAATAATGTTGGCAC
PLIN1 ACCTGGAGGAAAAGATCCCG TTCGAAGGCGGGTAGAGATG
Acsl1 CACAAGTGGAACTACAGGCAAC TGTGGAAGCGATGAATGCAC
CPT-1α CCTACCACGGCTGGATGTTT TACAACATGGGCTTCCGACC
ACOX1 TTTGGACCTTCACTTGGGCA TCGAAGATGAGTTCCATGACCC
Lcad GTCCGATTGCCAGCTAATGC CACAGGCAGAAATCGCCAAC
Mcad AAAAGAGCCTGGGAACTCGG CCATACGCCAACTCTTCGGT
PGC-1α AACCACACCCACAGGATCAG TGAGCAGGGACGTCTTTGTG
Nrf-1 ACGGCCTCATGTGTTTGAGT ACTCGCGTCGTGTACTCATC
Nrf-2 GCTGCTCGGACTAGCCATT ATCAAATCCATGTCCTGCTGGG
Tfam GGGAATGTGGAGCGTGCTAAA ACTTCGGAATACAGACAAGACTGA
Sirt1 AGCAGGTTGCAGGAATCCAA GCACCGAGGAACTACCTGATT