Home Food Science and Human Wellness Article
PDF (3 MB)
Cite
EndNote(RIS) BibTeX
Collect
Submit Manuscript
Show Outline
Figures (5)

Tables (4)
Table 1
Table 2
Table 3
Table 4
Article | Open Access

Desiccation and osmotic resistance mechanism of Cronobacter spp. isolated from powdered infant formula

Shiqian Fua, Danliangmin Songb, Xue Qinb, Lihan Wangb, Qianyu Zhaob, Chaoxin Manb, Xinyan Yangb(), Yujun Jiangb()
Key Laboratory of Animal Protein Food Deep Processing Technology of Zhejiang Province, Zhejiang-Malaysia Joint Research Laboratory for Agricultural Product Processing and Nutrition, College of Food Science and Engineering, Ningbo University, Ningbo 315800, China
Key Laboratory of Dairy Science, Ministry of Education, Department of Food Science, Northeast Agricultural University, Harbin 150030, China

Peer review under responsibility of Beijing Academy of Food Sciences.

Show Author Information

Highlights

• 35 isolates were identified as 4 species of Cronobacter by MALDI-TOF MS.

• Drying inactivation rate of the strains ranged from 9.01% to 77.57%.

• Biofilm forming ability was positively correlated with desiccation resistance.

• Maximum tolerable osmotic pressure of the strains was 6% NaCl.

• CysM, thuF and ycjO genes have been firstly found to be associated with tolerances.

Graphical Abstract

View original image Download original image

Abstract

Cronobacter spp. has strong resistance to desiccation and high permeability in Enterobacteriaceae, and powdered infant formula (PIF) is one of the main contamination routes. In recent years, the contamination of Cronobacter spp. in PIF incidents occurs from time to time, causing infant serious diseases or death. In this investigation, matrix-assisted laser desorption/ionization time of flight mass spectrometry was used to identify the phenotypes of 35 Cronobacter strains isolated from PIF and its processing environment. Subsequently, the isolates were evaluated for drying and osmotic pressure tolerance. The results showed that the deactivation rate of the strains ranged from 9.01% to 77.57%, and the highest osmotic pressure condition the strains could tolerate was 6 g/100 mL NaCl. In addition, there was a positive correlation between biofilm formation ability and desiccation resistance. Combined with transcriptomics, Cronobacter spp. could activate biofilm synthesis, produce more trehalose, accumulate betaine and electrolytes to stabilize intracellular structure under the two treatment conditions. A total of 31 and 43 genes were found related to desiccation and permeability resistance, respectively. And some genes (cysM, thuF, ycjO, etc.) were found to be associated with two tolerances for the first time.

Keywords

Powdered infant formulaCronobacter spp.Desiccation resistanceOsmotic resistanceTranscriptomics

References

[1]

S.J. Forsythe, Updates on the Cronobacter genus, Annu. Rev. Food Sci. Technol. 9 (2018) 23-44. https://doi.org/10.1146/annurev-food-030117-012246.

Crossref Google Scholar
[2]

S. Fu, X. Qin, Z. Wang, et al., Screening of specific nucleic acid targets for Cronobacter sakazakii and visual detection by loop-mediated isothermal amplification and lateral flow dipstick method in powdered infant formula, J. Dairy Sci. 104 (2021) 5152-5165. https://doi.org/10.3168/jds.2020-19427.

Crossref Google Scholar
[3]

I.M. Sulaiman, K. Tang, K. Segars, et al., Application of MALDI-TOF mass spectrometry, and DNA sequencing-based SLST and MLST analysis for the identification of Cronobacter spp. isolated from environmental surveillance samples, Arch. Microbiol. 203 (2021) 4813-4820. https://doi.org/10.1007/s00203-021-02465-6.

Crossref Google Scholar
[4]

S. Fu, Y. Jiang, X. Qin, et al., Electricity-free amplification and visual detection of Cronobacter species in powdered infant formula, J. Dairy Sci. 103 (2020) 6882-6893. https://doi.org/10.3168/jds.2019-17661.

Crossref Google Scholar
[5]

A.A. Elkhawaga, H.F. Hetta, N.S. Osman, et al., Emergence of Cronobacter sakazakii in cases of neonatal sepsis in Upper Egypt: first report in North Africa, Front. Microbiol. 11 (2020) 215. https://doi.org/10.3389/fmicb.2020.00215.

Crossref Google Scholar
[6]

Y.C. Bai, H.B. Yu, D. Guo, et al., Survival and environmental stress resistance of Cronobacter sakazakii exposed to vacuum or air packaging and stored at different temperatures, Front. Microbiol. 10 (2019) 303. https://doi.org/10.3389/fmicb.2019.00303.

Crossref Google Scholar
[7]

M.M. Hayman, S.G. Edelson-Mammel, P.J. Carter, et al., Prevalence of Cronobacter spp. and Salmonella in milk powder manufacturing facilities in the United States, J. Food Prot. 83 (2020) 1685-1692. https://doi.org/10.4315/jfp-20-047.

Crossref Google Scholar
[8]

X. Pei, Y. Li, H. Zhang, et al., Surveillance and characterisation of Cronobacter in powdered infant formula processing factories, Food Control 96 (2019) 318-323. https://doi.org/10.1016/j.foodcont.2018.09.009.

Crossref Google Scholar
[9]
B. Colin, B. Robert, C. Celia, et al., Enterobacter sakazakii and other microorganisms in powdered infant formula, Geneva: WHO, 2004.
[10]

R. Chauhan, N. Singh, G.K. Pal, et al., Trending biocontrol strategies against Cronobacter sakazakii: a recent updated review, Food Res. Int. 137 (2020) 109385. https://doi.org/10.1016/j.foodres.2020.109385.

Crossref Google Scholar
[11]

S.S. Han, Y.S. Jeong, S.K. Choi, Current scenario and challenges in the direct identification of microorganisms using MALDI TOF MS, Microorganisms 9 (2021) 1917. https://doi.org/10.3390/microorganisms9091917.

Crossref Google Scholar
[12]

S.K. Kailasa, J.R. Koduru, S.H. Baek, et al., Review on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry for the rapid screening of microbial species: a promising bioanalytical tool, Microchem. J. 159 (2020) 105387. https://doi.org/10.1016/j.microc.2020.105387.

Crossref Google Scholar
[13]

X.F. Chen, X. Hou, M. Xiao, et al., Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) analysis for the identification of pathogenic microorganisms: a review, Microorganisms 9 (2021) 1536. https://doi.org/10.3390/microorganisms9071536.

Crossref Google Scholar
[14]

Y. Lu, Y. Chen, X.A. Lu, et al., Comparison of methods for the microbiological identification and typing of Cronobacter species in infant formula, J. Dairy Sci. 97 (2014) 632-641. https://doi.org/10.3168/jds.2013-7147.

Crossref Google Scholar
[15]

G.G. Carvalho, A.P. Calarga, J.R. Teodoro, et al., Isolation, comparison of identification methods and antibiotic resistance of Cronobacter spp. in infant foods, Food Res. Int. 137 (2020) 109643. https://doi.org/10.1016/j.foodres.2020.109643.

Crossref Google Scholar
[16]

X.Q. Lou, H. Yu, X.C. Wang, et al., Potential reservoirs and routes of Cronobacter transmission during cereal growing, processing and consumption, Food Microbiol. 79 (2019) 90-95. https://doi.org/10.1016/j.fm.2018.12.004.

Crossref Google Scholar
[17]

S.Q. Fu, Y.J. Jiang, X. Jiang, et al., Probe-free label system for rapid detection of Cronobacter genus in powdered infant formula, AMB Express 8 (2018) 155. https://doi.org/10.1186/s13568-018-0689-x.

Crossref Google Scholar
[18]

P. Breeuwer, A. Lardeau, M. Peterz, et al., Desiccation and heat tolerance of Enterobacter sakazakii, J. Appl. Microbiol. 95 (2003) 967-973. https://doi.org/10.1046/j.1365-2672.2003.02067.x.

Crossref Google Scholar
[19]

P. Fei, Y. Jiang, J. Feng, et al., Antibiotic and desiccation resistance of Cronobacter sakazakii and C. malonaticus isolates from powdered infant formula and processing environments, Front. Microbiol. 8 (2017) 316. https://doi.org/10.3389/fmicb.2017.00316.

Crossref Google Scholar
[20]

L.C. Lin, L.R. Beuchat, Survival of Enterobacter sakazakii in infant cereal as affected by composition, water activity, and temperature, Food Microbiol. 24 (2007) 767-777. https://doi.org/10.1016/j.fm.2007.02.001.

Crossref Google Scholar
[21]

E. Lang, C. Iaconelli, F. Zoz, et al., Drying parameters greatly affect the destruction of Cronobacter sakazakii and Salmonella Typhimurium in standard buffer and milk, Food Microbiol. 62 (2017) 82-91. https://doi.org/10.1016/j.fm.2016.10.005.

Crossref Google Scholar
[22]

H. Xu, W. Huang, Q. Hou, et al., The effects of probiotics administration on the milk production, milk components and fecal bacteria microbiota of dairy cows, Sci. Bull. 62 (2017) 767-774. https://doi.org/10.1016/j.scib.2017.04.019.

Crossref Google Scholar
[23]

V. Laermann, E. Cudic, K. Kipschull, et al., The sensor kinase KdpD of Escherichia coli senses external K+, Mol. Microbiol. 88 (2013) 1194-1204. https://doi.org/10.1111/mmi.12251.

Crossref Google Scholar
[24]

P. Ogrodzki, S. Forsythe, Capsular profiling of the Cronobacter genus and the association of specific Cronobacter sakazakii and C. malonaticus capsule types with neonatal meningitis and necrotizing enterocolitis, BMC Genomics 16 (2015) 758. https://doi.org/10.1186/s12864-015-1960-z.

Crossref Google Scholar
[25]

P.A. Hingston, E.C. Stea, S. Knochel, et al., Role of initial contamination levels, biofilm maturity and presence of salt and fat on desiccation survival of Listeria monocytogenes on stainless steel surfaces, Food Microbiol. 36 (2013) 46-56. https://doi.org/10.1016/j.fm.2013.04.011.

Crossref Google Scholar
[26]

R.B. Hennekinne, L. Guillier, L. Fazeuilh, et al., Survival of Cronobacter in powdered infant formula and their variation in biofilm formation, Lett. Appl. Microbiol. 66 (2018) 496-505. https://doi.org/10.1111/lam.12879.

Crossref Google Scholar
[27]

L. Wang, S.J. Forsythe, X. Yang, et al., Invited review: stress resistance of Cronobacter spp. affecting control of its growth during food production, J. Dairy Sci. 104 (2021) 11348-11367. https://doi.org/10.3168/jds.2021-20591.

Crossref Google Scholar
[28]

A. Alvarez-Ordonez, M. Begley, T. Clifford, et al., Transposon mutagenesis reveals genes involved in osmotic stress and drying in Cronobacter sakazakii, Food Res. Int. 55 (2014) 45-54. https://doi.org/10.1016/j.foodres.2013.10.037.

Crossref Google Scholar
[29]

X.J. Du, X.Y. Wang, X. Dong, et al., Characterization of the desiccation tolerance of Cronobacter sakazakii strains, Front. Microbiol. 9 (2018) 2867. https://doi.org/10.3389/fmicb.2018.02867.

Crossref Google Scholar
[30]

H.X. Li, S.Q. Fu, D.L.M. Song, et al., Identification, typing and drug resistance of Cronobacter spp. in powdered infant formula and processing environment, Foods 12 (2023) 1084. https://doi.org/10.3390/foods12051084.

Crossref Google Scholar
[31]

N.S. Umeda, I. de Filippis, S.J. Forsythe, et al., Phenotypic characterization of Cronobacter spp. strains isolated from foods and clinical specimens in Brazil, Food Res. Int. 102 (2017) 61-67. https://doi.org/10.1016/j.foodres.2017.09.083.

Crossref Google Scholar
[32]

Q. Wang, S.J. Forsythe, X.J. Zhao, et al., Species identification and molecular characterization of Cronobacter spp. isolated from food imported over nine years into Beijing, China, Food Microbiol. 82 (2019) 11-19. https://doi.org/10.1016/j.fm.2019.01.011.

Crossref Google Scholar
[33]

P.H. Lebre, P. de Maayer, D.A. Cowan, Xerotolerant bacteria: surviving through a dry spell, Nat. Rev. Microbiol. 15 (2017) 285-296. https://doi.org/10.1038/nrmicro.2017.16.

Crossref Google Scholar
[34]

S. Srikumar, Y. Cao, Q.Q. Yan, et al., RNA sequencing-based transcriptional overview of xerotolerance in Cronobacter sakazakii SP291, Appl. Environ. Microb. 85 (2019) e01993-18. https://doi.org/10.1128/aem.01993-18.

Crossref Google Scholar
[35]

C.M. Burgess, A. Gianotti, N. Gruzdev, et al., The response of foodborne pathogens to osmotic and desiccation stresses in the food chain, Int. J. Food Microbiol. 221 (2016) 37-53. https://doi.org/10.1016/j.ijfoodmicro.2015.12.014.

Crossref Google Scholar
[36]

A. Feeney, R.D. Sleator, An in silico analysis of osmotolerance in the emerging gastrointestinal pathogen Cronobacter sakazakii, Bioeng. Bugs 2 (2011) 260-270. https://doi.org/10.4161/bbug.2.5.17238.

Crossref Google Scholar
[37]

R. Heermann, K. Zigann, S. Gayer, et al., Dynamics of an interactive network composed of a bacterial two-component system, a transporter and K+ as mediator, PLoS ONE 9 (2014) e89671. https://doi.org/10.1371/journal.pone.0089671.

Crossref Google Scholar
[38]

J.M. Wood, E. Bremer, L.N. Csonka, et al., Osmosensing and osmoregulatory compatible solute accumulation by bacteria, Comp. Biochem. Physiol. Part A: Mol. Integr. Physiol. 130 (2001) 437-460. https://doi.org/10.1016/s1095-6433(01)00442-1.

Crossref Google Scholar
[39]

M.F. Zhang, X.Y. Zhang, L.W. Tong, et al., Genes involved in tolerance to osmotic stress by random mutagenesis in Cronobacter malonaticus, J. Dairy Sci. 101 (2018) 3851-3858. https://doi.org/10.3168/jds.2017-13995.

Crossref Google Scholar
[40]

H. Jang, J. Woo, Y. Lee, et al., Draft genomes of Cronobacter sakazakii strains isolated from dried spices bring unique insights into the diversity of plant-associated strains, Stand. Genom. Sci. 13 (2018) 35. https://doi.org/10.1186/s40793-018-0339-6.

Crossref Google Scholar
[41]

Y. Ye, N. Ling, J. Gao, et al., Roles of outer membrane protein W (OmpW) on survival, morphology, and biofilm formation under NaCl stresses in Cronobacter sakazakii, J. Dairy Sci. 101 (2018) 3844-3850. https://doi.org/10.3168/jds.2017-13791.

Crossref Google Scholar
[42]

F. Negrete, H. Jang, J. Gangiredla, et al., Genome-wide survey of efflux pump-coding genes associated with Cronobacter survival, osmotic adaptation, and persistence, Curr. Opin. Food Sci. 30 (2019) 32-42. https://doi.org/10.1016/j.cofs.2018.11.005.

Crossref Google Scholar
Food Science and Human Wellness
Volume 14 Issue 3,
March 2025
Article number: 9250063
DOI: 10.26599/FSHW.2024.9250063
Cite this article:
Fu S, Song D, Qin X, et al. Desiccation and osmotic resistance mechanism of Cronobacter spp. isolated from powdered infant formula. Food Science and Human Wellness, 2025, 14(3): 9250063. https://doi.org/10.26599/FSHW.2024.9250063
Metrics & Citations  
Article History
Copyright
Rights and Permissions
Return

Bacterial strains used in this investigation and their sources.

StrainBacterial speciesSourceSequence typing
CS1C. sakazakiiPIF1
CS2C. sakazakiiPIF4
CM3C. malonaticusPIF7
CS4C. sakazakiiPIF8
CS5C. sakazakiiPIF12
CS6C. sakazakiiPIF13
CS7C. sakazakiiEnd product of workshop17
CS8C. sakazakiiPIF21
CS9C. sakazakiiPIF22
CS10C. sakazakiiPIF23
CS11C. sakazakiiPIF31
CS12C. sakazakiiPIF37
CS13C. sakazakiiPIF40
CS14C. sakazakiiPIF42
CS15C. sakazakiiWhey powder50
CM16C. malonaticusPIF60
CS17C. sakazakiiMilk powder raw materials64
CS18C. sakazakiiPIF73
CS19C. sakazakiiPIF83
CS20C. sakazakiiPIF198
CS21C. sakazakiiPIF199
CM22C. malonaticusPIF201
CT23C. turicensisPIF236
CM24C. malonaticusPIF258
CS25C. sakazakiiPIF259
CS26C. sakazakiiPIF268
CS27C. sakazakiiMilk powder raw materials269
CT28C. turicensisPIF367
CM29C. malonaticusPIF438
CS30C. sakazakiiPIF618
CD31C. dublinensisPIF788
CS32C. sakazakiiPIF789
CS33C. sakazakiiMilk powder additive790
CS81C. sakazakiiPIF260
CS100C. sakazakiiEnd product of workshop261

Target genes and primers of qRT-PCR.

GenePrimer sequence (5’→3’)
Desiccation resistance genescysM (CSK29544_02036)F: GCGAGATTAAGCCTGGCGATACG
R: CATCAGCAGCGTCATACGATACCC
proV (CSK29544_01829)F: GGCGATTGAGAAGGCGAACCATAG
R: GGGCTGTCTGTCGGCGTAAAAG
proX (CSK29544_01827)F: GGAAGCCGAAGTTATTGCCGTTTG
R: TTACACCTGGACGCCGTACTGG
betA (CSK29544_03339)F: CGGTGGCTCGTCGCTGATTAAC
R: TACGGTAATAGGGCAGGCAGTCG
proW (CSK29544_01828)F: CAATCACCACGCAGAACAACAGC
R: CCTGATCGCCTGGCAGATTTCC
kefF (CSK29544_00225)F: TCGGTTAAGCGTTTCAGGTATTCCC
R: CTGGCTAACACCCTATGCGATGC
otsB (CSK29544_02645)F: GGAATCGCTGGTCGCACATCTG
R: ATGCCATGCCTTTCGCCTCAAG
kdpB (CSK29544_03937)F: GGCAACATGGTGGATCTCGACTC
R: TTGGCGATGCTGAACGTGGTTAG
dnaK (CSK29544_00257)F: GTATGCAATGATTGAAGGCGTGGTG
R: GTAGCGATTATGGATGGCACTCAGG
yehX (CSK29544_02433)F: TGCTGATGGATAACGGCGAAGTG
R: TCCTTCACCTGTTTGAGCGACAAC
Osmotic resistance genesompC (CSK29544_02358)F: TCTGACCTACGATCTGGGCGAAG
R: TTCACCGAACAGGGCAGCATTG
thuF (CSK29544_04000)F: CAGCACGGAGTTCAGCAGACTG
R: CTGTTTACGCCCGCCTATTTCCC
proV (CSK29544_01829)F: GGCGATTGAGAAGGCGAACCATAG
R: GGGCTGTCTGTCGGCGTAAAAG
otsB (CSK29544_02645)F: GGAATCGCTGGTCGCACATCTG
R: ATGCCATGCCTTTCGCCTCAAG
opuB (CSK29544_02432)F: GCTGGCACCCGCTATCGTTATC
R: ATATTGAGCGCAGCGAACAGTCC
thuk (CSK29544_01363)F: ATATCGGCGGCAAGCGTATGAAC
R: AGCCACGGACAGATGCGGATAG
kefA (CSK29544_04091)F: CACTCCCAGTCCATCGGTTTGTTAC
R: TCAGCAGCAGTTAATGAGCGTCAG
opuA (CSK29544_03052)F: AGACCGTGTTGTGCTCGTAAAGAC
R: AGAAGCCGCTGGGATTTGTGAAG
ycjO (CSK29544_02903)F: TATGGCGTCGTGAACTGGATTGC
R: AGATGAAGGCGTAGGGGAAGTAGC
kdpA (CSK29544_03936)F: TCTCAGCCTACCAGCCGTTCAC
R: TGCGAGGAGTTGGCGTTAAAGAAG
16S rRNAF: GGTGTAGCGGTGAAATGCGTAGAG
R: CATCGTTTACGGCGTGGACTACC

Desiccation and osmotic resistance-related differentially expressed genes.

GeneGene annotationlog2 (Fold change)P-value
Desiccation conditions
cysM (CSK29544_02036)S-Sulfo-L-cysteine synthase2.538.11 × 10-9
dnaK (CSK29544_00257)Chaperone protein2.292.57 × 10-7
yehX (CSK29544_02433)Osmoprotectant uptake system ATP-binding protein-2.497.04 × 10-7
proV (CSK29544_01829)Glycine betaine/proline transport system ATP-binding protein3.565.82 × 10-6
proX (CSK29544_01827)Glycine betaine/proline transport system substrate-binding protein4.901.52 × 10-5
CSK29544_02774Potassium/proton antiporter-2.181.71 × 10-5
betA (CSK29544_03339)Choline dehydrogenase2.129.26 × 10-5
proW (CSK29544_01828)Glycine betaine/proline transport system permease protein3.412.19 × 10-4
kefC (CSK29544_00224)Glutathione-regulated potassium-efflux system protein-1.603.67 × 10-4
kdpC (CSK29544_03938)Potassium-transporting ATPase subunit C2.862.04 × 10-3
kefF (CSK29544_00225)Glutathione-regulated potassium-efflux system ancillary protein2.343.04 × 10-3
otsB (CSK29544_02645)Trehalose-6-phosphate phosphatase3.324.60 × 10-3
kdpB (CSK29544_03937)Potassium-transporting ATPase ATP-binding subunit3.186.06 × 10-3
kefA (CSK29544_04091)Potassium efflux protein2.097.18 × 10-3
otsA (CSK29544_02646)Trehalose-6-phosphate synthase2.157.25 × 10-3
kdpA (CSK29544_03936)Potassium-transporting ATPase potassium-binding subunit A2.108.99 × 10-3
Osmotic conditions
ompC (CSK29544_02358)Outer membrane pore protein C2.768.31 × 10-7
thuF (CSK29544_04000)Trehalose/maltose transport system permease protein2.194.39 × 10-5
proV (CSK29544_01829)Glycine betaine/proline transport system ATP-binding protein2.128.84 × 10-5
CSK29544_02724Putative solute/DNA competence effector-2.011.20 × 10-4
CSK29544_02468Putative chaperone1.641.50 × 10-4
dnaJ (CSK29544_02678)Domain-containing protein2.152.25 × 10-4
CSK29544_00672Potassium uptake protein2.003.22 × 10-4
otsB (CSK29544_02645)Trehalose-6-phosphate phosphatase3.846.68 × 10-4
CSK29544_04057ABC transporter ATP-binding protein2.398.76 × 10-4
CSK29544_02855Outer membrane protein W-1.939.59 × 10-4
opuB (CSK29544_02432)Osmoprotectant transport system permease protein3.371.53 × 10-3
thuk (CSK29544_01363)Multiple sugar transport system ATP-binding protein3.692.65 × 10-3
kefA (CSK29544_04091)Potassium efflux protein2.332.73 × 10-3
opuA (CSK29544_03052)Osmoprotectant transport system ATP-binding protein2.832.99 × 10-3
ycjO (CSK29544_02903)Inner membrane ABC transporter permease protein1.964.62 × 10-3
kefC (CSK29544_00224)Glutathione-regulated potassium-efflux system protein2.655.61 × 10-3
kdpA (CSK29544_03936)Potassium-transporting ATPase potassium-binding subunit A1.925.76 × 10-3
CSK29544_00505Putative membrane protein2.048.26 × 10-3
kdpC (CSK29544_03938)Potassium-transporting ATPase subunit C2.661.22 × 10-2
kdpB (CSK29544_03937)Potassium-transporting ATPase ATP-binding subunit2.571.31 × 10-2
dnaK (CSK29544_00257)Chaperone protein1.873.03 × 10-2
otsA (CSK29544_02646)Trehalose-6-phosphate synthase2.493.64 × 10-2

Changes of relative expression levels of some desiccation and permeability resistant differentially expressed genes by qRT-PCR.

Gene IDWeak resistance strainsStrong resistance strains
CM16CS5CS19CS21
Desiccation conditionscysM (CSK29544_02036)0.58 ± 0.200.82 ± 0.212.44 ± 0.162.51 ± 0.10
proV (CSK29544_01829)0.31 ± 0.150.64 ± 0.314.06 ± 0.224.23 ± 0.16
proX (CSK29544_01827)0.71 ± 0.211.06 ± 0.304.25 ± 0.265.16 ± 0.12
betA (CSK29544_03339)0.38 ± 0.080.55 ± 0.261.67 ± 0.132.48 ± 0.34
proW (CSK29544_01828)0.85 ± 0.171.23 ± 0.193.52 ± 0.243.98 ± 0.37
kefF (CSK29544_00225)0.35 ± 0.100.38 ± 0.091.90 ± 0.302.05 ± 0.22
otsB (CSK29544_02645)0.50 ± 0.180.71 ± 0.253.29 ± 0.203.75 ± 0.23
kdpB (CSK29544_03937)0.63 ± 0.250.69 ± 0.133.43 ± 0.173.62 ± 0.40
dnaK (CSK29544_00257)0.49 ± 0.190.48 ± 0.110.45 ± 0.210.41 ± 0.14
yehX (CSK29544_02433)0.68 ± 0.220.71 ± 0.270.40 ± 0.180.32 ± 0.21
Permeability conditionsompC (CSK29544_02358)0.82 ± 0.201.53 ± 0.113.21 ± 0.283.02 ± 0.23
thuF (CSK29544_04000)0.54 ± 0.190.68 ± 0.132.55 ± 0.172.60 ± 0.28
proV (CSK29544_01829)0.47 ± 0.060.56 ± 0.082.49 ± 0.222.54 ± 0.29
otsB (CSK29544_02645)1.03 ± 0.321.21 ± 0.225.87 ± 0.196.23 ± 0.37
opuB (CSK29544_02432)0.44 ± 0.070.50 ± 0.163.70 ± 0.303.67 ± 0.21
thuk (CSK29544_01363)0.39 ± 0.250.48 ± 0.242.50 ± 0.184.52 ± 0.16
kefA (CSK29544_04091)0.46 ± 0.270.77 ± 0.252.45 ± 0.232.88 ± 0.15
opuA (CSK29544_03052)0.54 ± 0.110.59 ± 0.131.96 ± 0.213.27 ± 0.17
ycjO (CSK29544_02903)0.83 ± 0.320.98 ± 0.181.38 ± 0.262.33 ± 0.20
kdpA (CSK29544_03936)0.65 ± 0.200.74 ± 0.292.05 ± 0.192.36 ± 0.22