Home Food Science and Human Wellness Article
PDF (10.7 MB)
Cite
EndNote(RIS) BibTeX
Collect
Submit Manuscript
Show Outline
Figures (7)

Tables (2)
Table 1
Table 2
Article | Open Access

Lard reduces obesity in mice compared with corn oil and canola oil via modulating gut microbiota and bile acid metabolism

Wusun Lia,1, Weida Wua,1, Yuhui Zhanga,1, Xiaoyan Tanga,b(), Xin Zhengc, Xinyuan Huanga,b
Key Laboratory of Agro-Product Quality and Safety, Institute of Quality Standards & Testing Technology for Agro-Products, Chinese Academy of Agricultural Sciences, Beijing 100081, China
College of Food Science and Technology, Nanjing Agricultural University, Nanjing 210095, China
Shimadzu (China) Co., Ltd., Beijing 100020, China

1 These author contributed equally to this article.

Peer review under responsibility of Tsinghua University Press.

Show Author Information

Highlights

• Lard reduced obesity and cholesterol level compared with corn oil and canola oil.

• Lard increased alpha diversity of gut microbiota compared with vegetable oils.

• Lard reduced relative abundance of gut microbiota (GM) associated with obesity.

• Corn oil and canola oil led to bile acid (BA) metabolism disorder.

• GM-BA-FXR pathway contributed to dietary fat-induced obesity phenotypic difference.

Graphical Abstract

View original image Download original image

Abstract

The association between dietary fat types and obesity is controversial, and the underlying mechanism remains unclear. This study aimed to evaluate the effect of different dietary fat sources (lard, corn oil or canola oil) on obesity in mice. The results revealed that lard-fed mice showed a lean phenotype, as well as lower serum cholesterol level compared with mice fed corn oil or canola oil. The 16S rRNA gene sequencing showed that the lard-fed mice had higher α-diversity of gut microbiota. In addition, the lard group had similar relative abundance of Lactobacillus, unclassified_f_Lachnospiraceae and Bacteroides compared with the control group. Targeted metabolomics analysis of caecal bile acid (BA) profile suggested the levels of chenodeoxycholic acid, lithocholic acid, deoxycholic acid and cholic acid in the lard group were higher than those in the corn oil and canola oil groups. Meanwhile, the levels of BA receptor farnesoid X receptor (Fxr) gene in lard-fed mice were higher than vegetable oil groups. These results suggested that lard could reduce the risk of obesity compared with corn oil and canola oil, which may be associated with more balanced gut microbiota and BA composition as well as activated FXR signaling.

Keywords

Dietary fatsObesityLardGut microbiotaBile acidFarnesoid X receptor

Electronic Supplementary Material

Download File(s)
fshw-14-3-9250070_ESM.docx (78.7 KB)

References

[1]
World Health Organization, Obesity and overweight, 2024. Available online: https://www.who.int/news-room/fact-sheets/detail/obesityand-overweight.
[2]

M. Wei, F. Huang, L. Zhao, et al., A dysregulated bile acid-gut microbiota axis contributes to obesity susceptibility, EBioMedicine 55 (2020) 102766. https://doi.org/10.1016/j.ebiom.2020.102766.

Crossref Google Scholar
[3]

N.J. Pillon, R.J.F. Loos, S.M. Marshall, et al., Metabolic consequences of obesity and type 2 diabetes: balancing genes and environment for personalized care, Cell 184 (2021) 1530-1544. https://doi.org/10.1016/j.cell.2021.02.012.

Crossref Google Scholar
[4]

B. Brayner, G. Kaur, M.A. Keske, et al., Dietary patterns characterized by fat type in association with obesity and type 2 diabetes: a longitudinal study of UK biobank participants, J. Nutr. 151 (2021) 3570-3578. https://doi.org/10.1093/jn/nxab275.

Crossref Google Scholar
[5]

X. Liu, Y. Li, D.K. Tobias, et al., Changes in types of dietary fats influence long-term weight change in US women and men, J. Nutr. 148 (2018) 1821-1829. https://doi.org/10.1093/jn/nxy183.

Crossref Google Scholar
[6]

U. Schwab, L. Lauritzen, T. Tholstrup, et al., Effect of the amount and type of dietary fat on cardiometabolic risk factors and risk of developing type 2 diabetes, cardiovascular diseases, and cancer: a systematic review, Food Nutr. Res. 58 (2014) 25145. https://doi.org/10.3402/fnr.v58.25145.

Crossref Google Scholar
[7]

F. Rosqvist, D. Iggman, J. Kullberg, et al., Overfeeding polyunsaturated and saturated fat causes distinct effects on liver and visceral fat accumulation in humans, Diabetes 63 (2014) 2356-2368. https://doi.org/10.2337/db13-1622.

Crossref Google Scholar
[8]

F. Moghtaderi, M. Amiri, A. Zimorovat, et al, The effect of canola, sesame and sesame-canola oils on body fat and composition in adults: a triple-blind, three-way randomised cross-over clinical trial, Int. J. Food Sci. Nutr. 72 (2021) 226-235. https://doi.org/10.1080/09637486.2020.1786024.

Crossref Google Scholar
[9]

T.A.B. Sanders, A. Filippou, S.E. Berry, et al., Palmitic acid in the sn-2 position of triacylglycerols acutely influences postprandial lipid metabolism, Am. J. Clin. Nutr. 94 (2011) 1433-1441. https://doi.org/10.3945/ajcn.111.017459.

Crossref Google Scholar
[10]

L.B. Muniz, A.M. Alves-Santos, F. Camargo, et al., High-lard and high-cholesterol diet, but not high-lard diet, leads to metabolic disorders in a modified dyslipidemia model, Arq. Bras. Cardiol. 113 (2019) 896-902. https://doi.org/10.5935/abc.20190149.

Crossref Google Scholar
[11]

S. Yan, H. Zhou, S. Liu, et al., Differential effects of Chinese high-fat dietary habits on lipid metabolism: mechanisms and health implications, Lipids Health Dis. 19 (2020) 30. https://doi.org/10.1186/s12944-020-01212-y.

Crossref Google Scholar
[12]

J. Fernández-Felipe, M. Valencia-Avezuela, B. Merino, et al., Effects of saturated versus unsaturated fatty acids on metabolism, gliosis, and hypothalamic leptin sensitivity in male mice, Nutr. Neurosci. 26 (2023) 173-186. https://doi.org/10.1080/1028415x.2022.2029294.

Crossref Google Scholar
[13]

R. Hosomi, A. Matsudo, K. Sugimoto, et al., Dietary fat influences the expression of genes related to sterol metabolism and the composition of cecal microbiota and its metabolites in rats, J. Oleo Sci. 68 (2019) 1133-1147. https://doi.org/10.5650/jos.ess19183.

Crossref Google Scholar
[14]

J. Wang, S. Yan, H. Xiao, et al., Anti-obesity effect of a traditional Chinese dietary habit-blending lard with vegetable oil while cooking, Sci. Rep. 7 (2017) 14689. https://doi.org/10.1038/s41598-017-14704-2.

Crossref Google Scholar
[15]

N.G. Forouhi, R.M. Krauss, G. Taubes, et al., Dietary fat and cardiometabolic health: evidence, controversies, and consensus for guidance, BMJ 361 (2018) k2139. https://doi.org/10.1136/bmj.k2139.

Crossref Google Scholar
[16]
Wu J.H.Y. Micha R. Mozaffarian D.Dietary fats and cardiometabolic disease: mechanisms and effects on risk factors and outcomesNat. Rev. Cardiol.20191658160110.1038/s41569-019-0206-1

J.H.Y. Wu, R. Micha, D. Mozaffarian, Dietary fats and cardiometabolic disease: mechanisms and effects on risk factors and outcomes, Nat. Rev. Cardiol. 16 (2019) 581-601. https://doi.org/10.1038/s41569-019-0206-1.

Crossref Google Scholar
[17]

E.Y. Huang, V.A. Leone, S. Devkota, et al., Composition of dietary fat source shapes gut microbiota architecture and alters host inflammatory mediators in mouse adipose tissue, J. Parenter. Enteral Nutr. 37 (2013) 746-754. https://doi.org/10.1177/0148607113486931.

Crossref Google Scholar
[18]

V.H. Matthias, D.C. Patrice, The gut microbiota in obesity and weight management: microbes as friends or foe?, Nat. Rev. Endocrinol. 19 (2023) 258-271. https://doi.org/10.1038/s41574-022-00794-0.

Crossref Google Scholar
[19]

A. Parséus, N. Sommer, F. Sommer, et al., Microbiota-induced obesity requires farnesoid X receptor, Gut 66 (2017) 429-437. https://doi.org/10.1136/gutjnl-2015-310283.

Crossref Google Scholar
[20]

E.L. Chatelier, T. Nielsen, J. Qin, et al., Richness of human gut microbiome correlates with metabolic markers, Nature 500 (2013) 541-546. https://doi.org/10.1038/nature12506.

Crossref Google Scholar
[21]

R. Ley, P. Turnbaugh, S. Klein, et al., Human gut microbes associated with obesity, Nature 444 (2006) 1022-1023. https://doi.org/10.1038/4441022a.

Crossref Google Scholar
[22]

J. Geng, Q. Ni, W. Sun, et al., The links between gut microbiota and obesity and obesity related diseases, Biomed. Pharmacother. 147 (2022) 112678. https://doi.org/10.1016/j.biopha.2022.112678.

Crossref Google Scholar
[23]

K.Y. Cho, Association of gut microbiota with obesity in children and adolescents, Clin. Exp. Pediatr. 66 (2023) 148-154. https://doi.org/10.3345/cep.2021.01837.

Crossref Google Scholar
[24]

R. Gao, C. Zhu, H. Li, et al., Dysbiosis signatures of gut microbiota along the sequence from healthy, young patients to those with overweight and obesity, Obesity 26 (2017) 351-361. https://doi.org/10.1002/oby.22088.

Crossref Google Scholar
[25]

M.A. Hildebrandt, C. Hoffmann, S.A. Sherrill-Mix, et al., High-fat diet determines the composition of the murine gut microbiome independently of obesity, Gastroenterology 137 (2009) 1716-1724. https://doi.org/10.1053/j.gastro.2009.08.042.

Crossref Google Scholar
[26]

K. Martinez-Guryn, N. Hubert, K. Frazier, et al., Small intestine microbiota regulate host digestive and absorptive adaptive responses to dietary lipids, Cell Host Microbe 23 (2018) 458-469. https://doi.org/10.1016/j.chom.2018.03.011.

Crossref Google Scholar
[27]

K.S. Chadaideh, R.N. Carmody, Host-microbial interactions in the metabolism of different dietary fats, Cell Metab. 33 (2021) 857-872. https://doi.org/10.1016/j.cmet.2021.04.011.

Crossref Google Scholar
[28]

M. Schoeler, R. Caesar, Dietary lipids, gut microbiota and lipid metabolism, Rev. Endocr. Metab. Disord. 20 (2019) 461-472. https://doi.org/10.1007/s11154-019-09512-0.

Crossref Google Scholar
[29]

H. Liu, H. Zhu, H. Xia, et al., Different effects of high-fat diets rich in different oils on lipids metabolism, oxidative stress and gut microbiota, Food Res. Int. 141 (2021) 110078. https://doi.org/10.1016/j.foodres.2020.110078.

Crossref Google Scholar
[30]

S. Devkota, Y. Wang, M.W. Musch, et al., Dietary-fat-induced taurocholic acid promotes pathobiont expansion and colitis in Il10-/- mice, Nature 487 (2012) 104-108. https://doi.org/10.1038/nature11225.

Crossref Google Scholar
[31]

R. Caesar, V. Tremaroli, P. Kovatcheva-Datchary, et al., Crosstalk between gut microbiota and dietary lipids aggravates WAT inflammation through TLR signaling, Cell Metab. 22 (2015) 658-668. https://doi.org/10.1016/j.cmet.2015.07.026.

Crossref Google Scholar
[32]

R. Kübeck, C. Bonet-Ripoll, C. Hoffmann, et al., Dietary fat and gut microbiota interactions determine diet-induced obesity in mice, Mol. Metab. 5 (2016) 1162-1174. https://doi.org/10.1016/j.molmet.2016.10.001.

Crossref Google Scholar
[33]

S.L. Collins, J.G. Stine, J.E. Bisanz, et al., Bile acids and the gut microbiota: metabolic interactions and impacts on disease, Nat. Rev. Microbiol. 21 (2023) 236-247. https://doi.org/10.1038/s41579-022-00805-x.

Crossref Google Scholar
[34]

H.S. Ejtahed, P. Angoorani, A.R. Soroush, et al., Gut microbiota-derived metabolites in obesity: a systematic review, Biosci. Microb. Food H. 39 (2020) 65-76. https://doi.org/10.12938/bmfh.2019-026.

Crossref Google Scholar
[35]

G. Kakiyama, A. Muto, H. Takei, et al., A simple and accurate HPLC method for fecal bile acid profile in healthy and cirrhotic subjects: validation by GC-MS and LC-MS, J. Lipid Res. 55 (2014) 978-990. https://doi.org/10.1194/jlr.D047506.

Crossref Google Scholar
[36]

S.B. Teasdale, S. Marshall, K. Abbott, et al., How should we judge edible oils and fats? An umbrella review of the health effects of nutrient and bioactive components found in edible oils and fats, Crit. Rev. Food Sci. 62 (2022) 5167-5182. https://doi.org/10.1080/10408398.2021.1882382.

Crossref Google Scholar
[37]

X. Guo, T. Zhang, L. Shi, et al., The relationship between lipid phytochemicals, obesity and its related chronic diseases, Food Funct. 9 (2018) 6048-6062. https://doi.org/10.1039/c8fo01026a.

Crossref Google Scholar
[38]

S.M. Innis, Dietary triacylglycerol structure and its role in infant nutrition, Adv. Nutr. 2 (2011) 275-283. https://doi.org/10.3945/an.111.000448.

Crossref Google Scholar
[39]

Y. Huang, N. Wang, H. Zhao, In vivo activities of the structured lipids-1,3-dioleic acid 2-palmitic acid triglyceride (OPO) in high-fat diet mice, Food Biosci. 47 (2022) 101667. https://doi.org/10.1016/j.fbio.2022.101667.

Crossref Google Scholar
[40]

J. Geng, Q. Ni, W. Sun, et al., The links between gut microbiota and obesity and obesity related diseases, Biomed. Pharmacother. 147 (2022) 112678. https://doi.org/10.1016/j.biopha.2022.112678.

Crossref Google Scholar
[41]

S. Just, S. Mondot, J. Ecker, et al., The gut microbiota drives the impact of bile acids and fat source in diet on mouse metabolism, Microbiome 6 (2018) 134. https://doi.org/10.1186/s40168-018-0510-8.

Crossref Google Scholar
[42]

Q. Zhao, Y. Fu, F. Zhang, et al., Heat-treated adzuki bean protein hydrolysates reduce obesity in mice fed a high-fat diet via remodeling gut microbiota and improving metabolic function, Mol. Nutr. Food Res. 66 (2022) e2100907. https://doi.org/10.1002/mnfr.202100907.

Crossref Google Scholar
[43]

A.D. Truax, L. Chen, J.W. Tam, et al., The inhibitory innate immune sensor NLRP12 maintains a threshold against obesity by regulating gut microbiota homeostasis, Cell Host Microbe 24 (2018) 364-378. https://doi.org/10.1016/j.chom.2018.08.009.

Crossref Google Scholar
[44]

Y. Yang, Y. Zhang, Y. Xu, et al., Dietary methionine restriction improves the gut microbiota and reduces intestinal permeability and inflammation in high-fat-fed mice, Food Funct. 10 (2019) 5952-5968. https://doi.org/10.1039/c9fo00766k.

Crossref Google Scholar
[45]

J. Wan, S. Hu, J.J. Jacoby, et al., The impact of dietary sn-2 palmitic triacylglycerols in combination with docosahexaenoic acid or arachidonic acid on lipid metabolism and host faecal microbiota composition in Sprague Dawley rats, Food Funct. 8 (2017) 1793-1802. https://doi.org/10.1039/c7fo00094d.

Crossref Google Scholar
[46]

J. Cai, L. Sun, F.J. Gonzalez, Gut microbiota-derived bile acids in intestinal immunity, inflammation, and tumorigenesis, Cell Host Microbe 30 (2022) 289-300. https://doi.org/10.1016/j.chom.2022.02.004.

Crossref Google Scholar
[47]

J. Hu, P. Zheng, J. Qiu, et al., High-amylose corn starch regulated gut microbiota and serum bile acids in high-fat diet-induced obese mice, Int. J. Mol. Sci. 23 (2022) 5905. https://doi.org/10.3390/ijms23115905.

Crossref Google Scholar
[48]

Z. Zeng, Y. Zhou, Y. Xu, et al., Bacillus amyloliquefaciens SC06 alleviates the obesity of ob/ob mice and improves their intestinal microbiota and bile acid metabolism, Food Funct. 13 (2022) 5381-5395. https://doi.org/10.1039/d1fo03170h.

Crossref Google Scholar
[49]

H. Duboc, C.C. Nguyen, J.B. Cavin, et al., Roux-en-Y Gastric-Bypass and sleeve gastrectomy induces specific shifts of the gut microbiota without altering the metabolism of bile acids in the intestinal lumen, Int. J. Obes. 43 (2019) 428-431. https://doi.org/10.1038/s41366-018-0015-3.

Crossref Google Scholar
[50]

J.S. Teodoro, I.F. Machado, A.C. Castela, et al., Chenodeoxycholic acid has non-thermogenic, mitodynamic anti-obesity effects in an in vitro CRISPR/Cas9 model of bile acid receptor TGR5 knockdown, Int. J. Mol. Sci. 22 (2021) 11738. https://doi.org/10.3390/ijms222111738.

Crossref Google Scholar
[51]

M. Zietak, L.P. Kozak, Bile acids induce uncoupling protein 1-dependent thermogenesis and stimulate energy expenditure at thermoneutrality in mice, Am. J. Physiol. Endocrinol. Metab. 310 (2016) E346-E354. https://doi.org/10.1152/ajpendo.00485.2015.

Crossref Google Scholar
[52]

Y. Zhang, X. Zheng, F. Huang, et al., Ursodeoxycholic acid alters bile acid and fatty acid profiles in a mouse model of diet-induced obesity, Front. Pharmacol. 10 (2019) 842. https://doi.org/10.3389/fphar.2019.00842.

Crossref Google Scholar
[53]

P. Guo, M. Xue, X. Teng, et al., Antarctic krill oil ameliorates liver injury in rats exposed to alcohol by regulating bile acids metabolism and gut microbiota, J. Nutr. Biochem. 107 (2022) 109061. https://doi.org/10.1016/j.jnutbio.2022.109061.

Crossref Google Scholar
[54]

Y. Ma, Y. Huang, L. Yan, et al., Synthetic FXR agonist GW4064 prevents diet-induced hepatic steatosis and insulin resistance, Pharm. Res. 30 (2013) 1447-1457. https://doi.org/10.1007/s11095-013-0986-7.

Crossref Google Scholar
[55]

Z.X. Yang, W. Shen, H. Sun, Effects of nuclear receptor FXR on the regulation of liver lipid metabolism in patients with non-alcoholic fatty liver disease, Hepatol. Int. 4 (2010) 741-748. https://doi.org/10.1007/s12072-010-9202-6.

Crossref Google Scholar
[56]

X. Song, Y. Liu, X. Zhang, et al., Role of intestinal probiotics in the modulation of lipid metabolism: implications for therapeutic treatments, Food Sci. Hum. Wellness 12 (2023) 11. https://doi.org/10.1016/j.fshw.2023.02.005.

Crossref Google Scholar
[57]

J. Cai, B. Rimal, C. Jiang, et al., Bile acid metabolism and signaling, the microbiota, and metabolic disease, Pharmacol. Ther. 237 (2022) 108238. https://doi.org/10.1016/j.pharmthera.2022.108238.

Crossref Google Scholar
[58]

F. Li, C. Jiang, K.W. Krausz, et al., Microbiome remodelling leads to inhibition of intestinal farnesoid X receptor signalling and decreased obesity, Nat. Commun. 4 (2013) 2384. https://doi.org/10.1038/ncomms3384.

Crossref Google Scholar
[59]

J.J. Repa, K.E. Berge, C. Pomajzl, et al., Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors α and β, J. Biol. Chem. 277 (2002) 18793-18800. https://doi.org/10.1074/jbc.M109927200.

Crossref Google Scholar
[60]

J. Henkel, E. Alfine, J. Saín, et al., Soybean oil-derived poly-unsaturated fatty acids enhance liver damage in NAFLD induced by dietary cholesterol, Nutrients 10 (2018) 1326. https://doi.org/10.3390/nu10091326.

Crossref Google Scholar
Food Science and Human Wellness
Volume 14 Issue 3,
March 2025
Article number: 9250070
DOI: 10.26599/FSHW.2024.9250070
Cite this article:
Li W, Wu W, Zhang Y, et al. Lard reduces obesity in mice compared with corn oil and canola oil via modulating gut microbiota and bile acid metabolism. Food Science and Human Wellness, 2025, 14(3): 9250070. https://doi.org/10.26599/FSHW.2024.9250070
Metrics & Citations  
Article History
Copyright
Rights and Permissions
Return

The composition of chow diets (g/kg).

Ingredients Control Lard Canola oil Corn oil
Casein 24 24 24 24
Maize starch 45.9 26.7 26.7 26.7
Maltodextrin 5.6 5.6 5.6 5.6
Sugar 5 5 5 5
Cellulose 5 5 5 5
Vitamin mix 6 6 6 6
Mineral element mix 1.2 1.2 1.2 1.2
Soybean oil 5 0 0 0
Lard 0 25 0 0
Canola oil 0 0 25 0
Corn oil 0 0 0 25
L-Cysteine 0.2 0.2 0.2 0.2
Choline 0.2 0.2 0.2 0.2

The sequences of the primers for RT-qPCR assays.

Gene Sense (5’-3’) Antisense (5’-3’)
Cyp7a1 GCCAGAGTCCAATGCTTAGG ATCTCACACCAGGGTAAATGC
Cyp27a1 GCCTCACCTATGGGATCTTCA TCAAAGCCTGACGCAGATG
Cyp8b1 GCCTTCAAGTATGATCGGTTCCT GATCTTCTTGCCCGACTTGTAGA
Fxr TGCGATTACCACCACCACCTG CCGAACTTTAGCCAGCCACCA
Hmg AGCTTGCCCGAATTGTATGTG TCTGTTGTGAACCATGTGACTTC
Ostα TACAAGAACACCCTTTGCCC CGAGGAATCCAGAGACCAAA
Ostβ GTATTTTCGTGCAGAAGATGCG TTTCTGTTTGCCAGGATGCTC
Abcg5 TCAATGAGTTTTACGGCCTGAA GCACATCGGGTGATTTAGCA
Abcg8 TGCCCACCTTCCACATGTC ATGAAGCCGGCAGTAAGGTAGA
Bsep AAGCTACATCTGCCTTAGACACAGAA CAATACAGGTCCGACCCTCTCT
Mrp4 CAAAGACATCGGACACATGG CAAAGACATCGGACACATGG
Ntcp AAATCGGATGGTTTGACTGC GGCAATGGCTTCATCAATTT
Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA