Home Nano Biomedicine and Engineering Article
PDF (2.7 MB)
Cite
EndNote(RIS) BibTeX
Collect
Submit Manuscript
Show Outline
Figures (4)

Tables (10)
Table 1
Table 2
Table 3
Table 4
Table 5
Show 5 more tables Hide 5 tables
Research Article | Open Access

Molecular Study of Colibacillosis Susceptibility in Calves and Lambs

Hawraa Judi1(), Rawaa Judi2, Abdul-Kareem Saqban1
Department of Microbiology, College of Veterinary Medicine, Al-Qasim Green University, Iraq
Laboratory Division, Babylon Veterinary Teaching Hospital, Iraq
Show Author Information

Abstract

Single nucleotide polymorphism (SNP) is hereditary change in a DNA sequence that occurs when a single nucleotide in a genome is modified; SNPs are usually considered to be point mutations that have been evolutionarily successful enough to recur in a significant proportion of the population of a species. The ability of certain individuals to respond appropriately to Toll-like receptor (TLR) ligands may be impaired by single-nucleotide polymorphisms (SNPs) within TLR genes, terminating in a modified susceptibility to infectious or in?ammatory disease that might contribute to the pathogenesis of complex diseases. Out of the 400 clinical samples of blood collected from calves and lambs suffering from diarrhea, the samples originated from Babylon Veterinary Teaching Hospital and Veterinary Clinics during the period from October 2018 to January 2019, 200 samples were suffering from diarrhea (100 samples of calves and 100 samples of lambs), and 200 samples were the control groups. Genotyping of TLR4 polymorphisms was carried out by using amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique. For calves' TLR4 (rs8193046) gene polymorphisms, the results showed there were significant differences in genotypes and alleles frequencies between the diarrheic cases and control groups (p < 0.05). GG homozygous genotype was overrepresented among diarrheic calves. The frequencies of G allele was higher in diarrheic calves compared to control groups. The calves' GG homozygous genotype was significantly associated with increased susceptibility to Colibacillosis in calves. For lamb-TLR4 (rs160202325) gene polymorphism, AG heterozygous genotype was overrepresented among the cases as of 20 (52.63%), whereas AA was obviously more presented among control individuals as of 6 (60%). There were no difference between diarrheic cases and control groups for allele frequencies.

Keywords

DiarrheaGene polymorphismTLR4CalvesLambsARMS-PCR

References

[1]

H.A. Abdi, M.R. Ghalehnoo, Virulence genes genetic diversity, antimicrobial susceptibility and phylogenetic background of Escherichia coli isolates. Int. J. Enteric. Pathog, 2015, 3(3): 6-12.

Crossref Google Scholar
[2]

S. Bandyopadhyay, A. Mahanti, I. Samanta, et al., Virulence repertoire of Shiga toxin-producing Escherichia coli (STEC) and enterotoxigenic Escherichia coli (ETEC) from diarrhoeic lambs of Arunachal Pradesh, India. Trop. Anim. Hlth. Prod., 2011, 43(3): 705-710.

Crossref Google Scholar
[3]

E. Bozçal, G. Yiğittürk, A. Uzel, et al., Investigation of enteropathogenic Escherichia coli and Shiga toxin-producing Escherichia coli associated with hemolytic uremic syndrome in İzmir Province, Turkey. Turk J Med Sci, 2016, 46: 733-741.

Crossref Google Scholar
[4]

M.A. Croxen, R.J. Law, R. Scholz, et al., Recent advances in understanding enteric pathogenic Escherichia coli. Clin. Microbiol. Rev., 2013, 26(4): 822-880.

Crossref Google Scholar
[5]

J.B. Kaper, J.P. Nataro, Mobley, Pathogenic Escherichia coli. Nat Rev Microbiol, 2004, 2(2): 123-140.

Crossref Google Scholar
[6]

O. Tenaillon, D. Skurnik, B. Picard, et al., The population genetics of commensal Escherichia coli. Nat Rev Microbiol, 2010, 8: 207-217.

Crossref Google Scholar
[7]

V.K. Sharma, M. Sharma, R. Katoch, et al., Recovery of some important serotypes of E. coli from diarrhoeic and apparently healthy calves in palam valley of himachal pradesh. International Journal of Cow Science, 2006, 2(1): 34-36.

Google Scholar
[8]

S. Mailk, A. Kumar, A.K. Verma, et al., Incidence and drug resistance pattern of Collibacillosis in cattle and buffalo calves in Western Utter Pradesh in India. Journal of Animal Health and Production, 2013, 1: 15-19.

Google Scholar
[9]

A. Li, L. Zhang, Q. Yao, et al., Pathogen blocks host death receptor signalling by arginine GlcNAcylation of death domains. Nature, 2013, 501(7466): 242-246.

Crossref Google Scholar
[10]

T.H. Mogensen, Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev., 2009, 22(2): 240-273.

Crossref Google Scholar
[11]

M. Muzio, J. Ni, P. Feng, et al., IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science, 2010, 278(5343): 1612-1615.

Crossref Google Scholar
[12]

J.D. Behl, A. Sharma, R.S. Kataria, et al., Genetic polymorphisms in the bovine Toll-like receptor 4 (TLR4) and monocyte chemo attractant protein-1(CCL2) genes: SNPs distribution analysis in Bos indicus Sahiwal cattle breed. Animal Biotechnology, 2014, 25(4): 250-265.

Crossref Google Scholar
[13]

F. Rosa, S. Busato, F.C. Avaroma, et al., Transcriptional changes detected I n fecal RNA of neonatal dairy calves undergoing a mild diarrhea are associated with inflammatory biomarkers. PLoS ONE, 2016, 13(1): e0191599.

Crossref Google Scholar
[14]

J. Reeb, M. Hecht, Y. Mahlich, et al., Predicted molecular effects of sequence variants link to system level of disease. PLoS Comput Biol, 2016, 12(8): 20-25.

Crossref Google Scholar
[15]

C. Mishra, S. Kumar, and H.M. Yathish, Predicting the effect of non-synonymous SNPs in Bovine TLR4 gene. Gene Reports, 2016, 16(1): 10-16.

Crossref Google Scholar
[16]

C.M. Seabury, P.M. Seabury, J.E. Decker, et al., Diversity and evolution of 11 innate immune genes in Bos taurus Taurus and Bos taurus indicus cattle. Proc. Natl. Acad. Sci., 2010, 107(1): 151-156.

Crossref Google Scholar
[17]

F. Mariotte, A. Mayor, and J. Tschopp, The inflammasomes: guardians of the body. Annu. Rev. Immunol., 2009, 27(111): 229-265.

Crossref Google Scholar
[18]

G. Banos, G. Bramis, S. Bush, et al., The genomic architecture of mastitis resistance in dairy sheep. BMC Genomics, 2017, 18(1): 624-630.

Crossref Google Scholar
[19]

G. Davies, S. Genini, S.C. Bishop, An assessment of opportunities to dissect host genetic variation in resistance to infectious diseases in livestock. Animal, 2009, 3(3): 415-436.

Crossref Google Scholar
[20]

M. Tolone, C. Larrondo, J.M. Yáñez, et al., Assessment of genetic variation for pathogen-specific mastitis resistance in Valle del Belice dairy sheep. BMC Vet Res, 2016, 12(1): 158.

Crossref Google Scholar
Nano Biomedicine and Engineering
Volume 12 Issue 2,
June 2020
Pages 153-159
DOI: 10.5101/nbe.v12i2.p153-159
Cite this article:
Judi H, Judi R, Saqban A-K. Molecular Study of Colibacillosis Susceptibility in Calves and Lambs. Nano Biomedicine and Engineering, 2020, 12(2): 153-159. https://doi.org/10.5101/nbe.v12i2.p153-159
Metrics & Citations  
Article History
Copyright
Rights and Permissions
Return

ARMS-PCR primers for lambs\' TLR4 with their sequence and amplicon size with SNP

ARMSPCR primer Sequence Product size SNP
Allele A primer Forward AGAGCACCTATGATGCCTTTGTA 526 bp rs160202325
Allele G primer Forward AGCACCTATGATGCCTTTGTG 524 bp
Common reverse primers GGGGATTCTCCTCCTCAGGT

ARMS-PCR primers for calves\' TLR4 with their sequence and amplicon size with SNP

ARMS PCR primer Sequence Product size SNP
Allele A Primer Forward GCATGCAGGAAGACACCG 590 bp rs8193046
Allele G Primer Forward GCATGCAGGAAGACACCA 590 bp
Common Reverse Primers GCCCTCCTGAATAGCTAGGG

ARMS-PCR master mix reaction for wild type allele

PCR master mix Volume (µL)
Genomic DNA (5 - 50 ng) 5
Generic primer (10 pmol) 1
Wild type (T allele) primer (10 pmol) 1
PCR water 13
Total 20

ARMS-PCR master mix reaction for mutant type allele

PCR master mix Volume (µL)
Genomic DNA (5 - 50 ng) 5
Generic primer (10 pmol) 1
Mutant (C allele) primer (10 pmol) 1
PCR water 13
Total 20

PCR thermocycler conditions

ARMS-PCR step Temperature (℃) Time (sec) Repeat (cycle)
Initial denaturation 95 300 1
Denaturation 95 30 30
Annealing 60 45
Extension 72 30
Final extension 72 300 1
Hold 4 Forever --

Alleles frequencies of calve TLR4 (rs8193046) gene polymorphisms in infected and control groups

Allele Case Control OR (95% CI) P-value*
Count Proportion Count Proportion
Note: OR = Odd ratio; CI = Confidence intervals.
A 28 36.84% 14 70% 0.2500 (0.0863 - 0.7244) 0.011
G 48 63.15% 6 30% 4 (1.3804 - 11.5907)

Genotype frequencies of calve TLR4 (rs8193046) gene polymorphisms in cases and control groups

Genotype Control No. 10 Case No. 38 OR (95% CI) P-value
AA 6 (60%) 7 (18.42%) 0.1505 (0.033 - 0.6799) 0.013
AG 2 (20%) 14 (36.84%) 2.3333 (0.5814 - 11.5605) 0.324
GG 2(20) 17 (44.73%) 3.2381 (0.3103 - 25.137) 0.169

Allele frequencies of lamb TLR2 (rs160202325) gene polymorphisms in cases and control groups

Allele Control Case OR (95% CI) P-value*
Count Proportion Count Proportion
Note: OR = Odd ratio; CI = Confidence intervals.
A 15 75% 38 50% 0.3333 (0.1101-1.0090) 0.051
G 5 25% 35 50% 3 (0.9911-9.0806)

Genotype frequencies of lamb TLR4 (rs160202325) gene polymorphisms in diarrheic cases and control groups

Genotype Control No.10 Case No.38 OR (95% CI) P-value
AA 6 (60%) 9 (23.68%) 0.2069 (0.0476-0.8996) 0.035
AG 3 (30%) 20 (52.63%) 2.592 (0.5814-11.5605) 0.211
GG 1 (10%) 9 (23.68%) 2.7931 (0.3103-25.137) 0.359

Genotype frequencies of lamb TLR4 (rs160202325) gene polymorphisms in diarrheic cases and control groups

Genotype Control No.10 Case No.38 OR (95% CI) P-value
AA 6 (60%) 9 (23.68%) 0.2069 (0.0476-0.8996) 0.035
AG 3 (30%) 20 (52.63%) 2.592 (0.5814-11.5605) 0.211
GG 1 (10%) 9 (23.68%) 2.7931 (0.3103-25.137) 0.359